Korean J Physiol Pharmacol 2022; 26(6): 541-556
Published online November 1, 2022 https://doi.org/10.4196/kjpp.2022.26.6.541
Copyright © Korean J Physiol Pharmacol.
Junxiong Zhao1,2,#, Qian Wu3,#, Ting Yang1,4,#, Liangui Nie2, Shengquan Liu2, Jia Zhou5, Jian Chen6, Zhentao Jiang7, Ting Xiao8,*, Jun Yang2,*, and Chun Chu1,*
1Department of Pharmacy, The Second Affiliated Hospital, Hengyang Medical School, University of South China, Hengyang 421000, 2Department of Cardiology, The First Affiliated Hospital, Hengyang Medical School, University of South China, Hengyang 421000, 3Department of General Practice, The Second Affiliated Hospital, Hengyang Medical School, University of South China, Hengyang 421000, 4School of Pharmaceutical Science of University of South China, Hengyang 421000, 5Department of Ultrasound Medicine, The First Affiliated Hospital, Hengyang Medical School, University of South China, Hengyang 421000, 6Department of Critical Care Medicine, The Affiliated Nanhua Hospital, Hengyang Medical School, University of South China, Hengyang 421000, 7Department of Cardiology, The Affiliated Nanhua Hospital, Hengyang Medical School, University of South China, Hengyang 421000, 8Department of Cardiology, Shenzhen Longhua District Central Hospital, Longhua Central Hospital Affiliated Guang-dong Medical University, Shenzhen 518000, China
Correspondence to:Chun Chu
E-mail: yjchuchun@163.com
Jun Yang
E-mail: yangjunketizu@163.com
Ting Xiao
E-mail: 1459593600@qq.com
Author contributions: J.Z. and Q.W. were responsible for the execution of the experiments and the writing of the manuscript. T.Y., L.N., S.L., and J.Z. participated in molecular biology testing and experimental design, J.C. and Z.J. were responsible for the execution of experiments and data analysis. T.X., J.Y., and C.C. were responsible for the design of the experiment. All authors contributed to this work and approved the submitted version.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Myocardial fibrosis is a key link in the occurrence and development of diabetic cardiomyopathy. Its etiology is complex, and the effect of drugs is not good. Cardiomyocyte apoptosis is an important cause of myocardial fibrosis. The purpose of this study was to investigate the effect of gaseous signal molecule sulfur dioxide (SO2) on diabetic myocardial fibrosis and its internal regulatory mechanism. Masson and TUNEL staining, Western-blot, transmission electron microscopy, RT-qPCR, immunofluorescence staining, and flow cytometry were used in the study, and the interstitial collagen deposition, autophagy, apoptosis, and changes in phosphatidylinositol 3-kinase (PI3K)/AKT pathways were evaluated from in vivo and in vitro experiments. The results showed that diabetic myocardial fibrosis was accompanied by cardiomyocyte apoptosis and down-regulation of endogenous SO2-producing enzyme aspartate aminotransferase (AAT)1/2. However, exogenous SO2 donors could up-regulate AAT1/2, reduce apoptosis of cardiomyocytes induced by diabetic rats or high glucose, inhibit phosphorylation of PI3K/AKT protein, up-regulate autophagy, and reduce interstitial collagen deposition. In conclusion, the results of this study suggest that the gaseous signal molecule SO2 can inhibit the PI3K/AKT pathway to promote cytoprotective autophagy and inhibit cardiomyocyte apoptosis to improve myocardial fibrosis in diabetic rats. The results of this study are expected to provide new targets and intervention strategies for the prevention and treatment of diabetic cardiomyopathy.
Keywords: Apoptosis, Autophagy, Myocardial fibrosis, PI3K/AKT pathway, Sulfur dioxide
The global prevalence of type 2 diabetes remains high, with the number of people projected to reach 693 million in 2045 [1]. Diabetes has become a serious burden on patients’ families and society due to its serious complications and poor prognosis. Diabetes can cause persistent damage to systemic organs [2], and cardiovascular complications are the leading cause of death in patients with diabetes, especially those with type 2 diabetes [3]. Diabetic cardiomyopathy, as one of the independent and important cardiovascular complications of diabetes, is also an important cause of death and disability in patients with type 2 diabetes [4-7]. Diabetic cardiomyopathy, which can lead to poor prognosis, such as heart failure and acute cardiovascular events [8,9], has become a major public health problem worldwide in the chronic disease management of diabetes.
The key link in the occurrence and development of diabetic cardiomyopathy is myocardial fibrosis. Myocardial fibrosis is pathological remodeling of the myocardium characterized by myocardial cell loss, excessive deposition of myocardial extracellular matrix, and changes in the phenotype of cardiac fibroblasts [10]. Various injury factors can promote the imbalance of myocardial cell homeostasis to induce myocardial cell apoptosis, resulting in pathological myocardial remodeling, reduced ventricular wall motility, and heart failure [11]. The pathogenesis of diabetic myocardial fibrosis is not very clear at present, and there is currently a lack of clear and effective clinical interventions for diabetic myocardial fibrosis.
Apoptosis, the most common way of programmed cell death, plays an important role in the pathological outcome of many diseases. Studies have shown that high glucose levels caused by diabetes can produce glucotoxicity and lead to cardiomyocyte apoptosis, and high glucose can cause mitochondrial damage and ROS accumulation in cardiomyocytes. Finally, the apoptosis program is initiated, which can lead to diabetic cardiomyopathy [12-14]. Moderate autophagy is critical for cellular homeostasis under stress, and glucotoxicity from high glucose levels inhibits cardiomyocyte autophagy [14-16]. Impairment of autophagy can lead to cardiomyocyte apoptosis, excessive repair of fibrosis, and pathological remodeling [17]. However, the role of autophagy in cardiomyocyte apoptosis and myocardial fibrosis induced by type 2 diabetes is still unclear and needs further study.
As an important pathway mediating autophagy, the phosphatidylinositol 3-kinase (PI3K)/AKT (AKTV-murine thymoma viral oncogene/protein kinase B) signaling pathway can regulate cell survival and homeostasis, and is an important target of cardiovascular disease [18,19]. Excessive activation of the PI3K/AKT signaling pathway induced by a high-glucose and high-fat environment can lead to abnormal organ function. A recent study found that the PI3K/AKT pathway was significantly up-regulated in the myocardial tissue of rats with diabetic cardiomyopathy, accompanied by impaired autophagosome formation and defective autophagy [20]. Previous studies have found that inhibition of PI3K/AKT can activate autophagy, thereby alleviating fibrosis and cell damage [21,22]. In the process of myocardial fibrosis, inhibiting the excessive activation of PI3K/AKT can inhibit the progression of myocardial fibrosis [23]. In addition, studies have shown that in the myocardial tissue of rats with diabetic cardiomyopathy, inhibiting the activation of the PI3K/AKT signaling pathway can reduce oxidative stress, thereby improving impaired cardiac function and reducing pathological changes such as fibrosis [24]. However, the role of PI3K/AKT-mediated autophagy in the occurrence and development of diabetic cardiomyopathy is still unclear.
Sulfur dioxide (SO2) is generally known as “a toxic gas.” But in recent years, it has been found that SO2 is also an important endogenous gas signal molecule like NO and CO. SO2 can be endogenously generated
Therefore, this study intends to construct the diabetic rat model and give exogenous SO2 donors to observe the effect of gas signaling molecule SO2 on myocardial cell apoptosis and myocardial fibrosis in rats with type 2 diabetes and to explore whether its mechanism is related to the regulation of autophagy by PI3K/AKT pathway.
Streptozotocin (STZ), Na2SO3, NaHSO3, D-glucose, and HDX (serine racemase inhibitor) were purchased from Sigma-Aldrich (St. Louis, MO, USA). PI3K/AKT activator 740 Y-P was provided by MedChemExpress (Shanghai, China). PI3K (67071-1-Ig), AKT (10176-2-AP), Beclin1 (11306-1-AP), LC3 (14600-1-AP), Atg5 (10181-2-AP), Atg16L1 (19812-1-AP), P62 (66184-1-Ig), AAT1 (14886-1-AP), AAT2 (14800-1-AP), Caspase3 (19677-1-AP), Caspase9 (10380-1-AP), Bax (50599-2-Ig), Bcl2 (26593-1-AP), MMP3 (66338-1-Ig), MMP8 (17874-1-AP), MMP13 (18165-1-AP), CollagenIII (22734-1-AP), and GAPDH (10494-1-AP) primary antibodies and mouse/rabbit secondary antibodies were purchased from Proteintech (Wuhan, China). P-PI3K (4228S) and P-AKT (9614T) primary antibodies were offered by Cell Signaling Technology (Beverly, MA, USA). Gel configuration kits and BCA protein quantification kits were purchased from Biyuntian Institute of Biotechnology (Shanghai, China). ECL chemiluminescence kit was provided by New Cell and Molecular Biotech Co., Ltd. (Suzhou, China). AnnexinV-fluorescein isothiocyanate/propidium iodide (AV-FITC/PI) apoptosis detection kit was purchased from Keygene Biotech Co., Ltd. (Nanjing, China).
The animal experiments were performed in accordance with the guidelines for the welfare and use of laboratory animals and gained approval from the Animal Ethics Committee of the University of South China, according to the animal management regulations and specifications of the Laboratory Animal Center of University of South China. A total of 40 8-week-old male Sprague–Dawley (SD) rats were randomly assigned to four groups (n = 10). The type II diabetes rats model was established through the single intraperitoneal injection of STZ (35 mg/kg, Sigma-Aldrich; dissolved in citric acid-sodium citrate buffer, pH 4.5) combined with a diet high in fat and sugar for eight weeks before STZ intraperitoneal injection [28]. The Control group and the SO2 group were given an equal amount of citric acid-sodium citrate buffer through intraperitoneal injection. One week after the injection, fasting blood glucose levels of the rats > 16.7 mM indicated that the type II diabetes rat model was successfully established, and diabetic rats were continuously given a diet high in sugar and fat. Subsequently, the diabetic cardiomyopathy (DC) + SO2 and SO2 groups were given exogenous SO2 donor (Na2SO3/NaHSO3, 85 mg/kg/d, Sigma-Aldrich) intraperitoneally for eight weeks [29], and the Control group and the DC groups were given equal amounts of saline intraperitoneally (Fig. 1). The heart tissues were collected after eight weeks of SO2 intervention for follow-up assays, and the heart weight and the pre-execution weight were weighed to calculate the HW/BW value. 8-week-old male SD rats were purchased from HUNAN SJA Laboratory Animal Co. (Changsha, China).
After eight weeks of STZ injection, all rats were gavaged with 50% glucose solution for the glucose tolerance test, and tail vein blood specimens were collected at 30, 60, and 120 min to measure the blood glucose levels. Fasting blood glucose and fasting insulin levels were collected from the rats at the time of devotion and homeostasis model assessment of insulin resistance (HOMA-IR) values were obtained.
After all rats were anesthetized with 4% chloral hydrate (400 mg/kg), the changes of left ventricular end-diastolic-dimension (LVEDD), left ventricular end-systolic dimension (LVESD), and left ventricular fractional shortening (LVFS) values were measured using M-mode ultrasound.
Myocardial tissues were fixed with 4% paraformaldehyde, paraffin-embedded after dehydration by gradient alcohol, made into 4 μm thin sections by microtome, and stained in accordance with the instructions of the Masson staining kit (Abiowell Biotech Co., Ltd., Changsha, Hunan), and sealed by treacle. The staining of the tissues was observed under a light microscope. The fixed and embedded myocardial tissues were made into 4um thin sections, and the corresponding operations were performed in accordance with the instructions of the TUNEL staining kit (Keygene Biotech Co., Ltd.). The staining was observed under a light microscope.
The myocardial tissues were fixed by 2.5% glutaraldehyde and cut into 50–100 nm thin sections, and phosphoric acid rinsing solution (Beyotime Institute of Biotechnology, Shanghai, China) was used. After being immersed in 1% osmium tetroxide (Absin Biosciences, Inc., Shanghai, China), the tissues were fixed and rinsed with phosphoric acid, followed by gradient acetone immersion. After being dehydrated and dried, the tissues were stained with 3% uranyl acetate and lead nitrate for 10–20 min and rinsed with distilled water. The ultrastructure was observed under transmission electron microscopy.
H9c2 cardiomyocyte cell line was purchased from ATCC (Manassas, VA, USA) and incubated in DMEM medium supplemented with 5.5 mM D-glucose with 10% fetal bovine serum and 1% penicillin/streptomycin at 37°C and 5% CO2. The cells were inoculated in 6-well plates when the cell density was close to 1 × 106 and incubated with a medium supplemented with high D-glucose (33 mM). The cells were assigned to the Control group, the HG group, the HG + SO2 group, the HG + SO2 + serine racemase inhibitor (HDX) group, the HG + SO2 + 740 Y-P group, and the SO2 group in accordance with different treatments. The Control group and SO2 group were cultured with low D-glucose medium (5.5 mM), and the HG group and HG + SO2 group, and HG + SO2 + HDX group were treated with high D-glucose medium (33 mM) for 24 h at 37°C. The exogenous SO2 donor Na2SO3/NaHSO3 (50 μM, 3:1 mol rate) was introduced to the HG + SO2 group and HG + SO2 + HDX group for the 0.5-h pretreatment as described previously [30], and then co-incubated with high D-glucose medium. Besides, the HG + SO2 + HDX group was co-incubated with the endogenous SO2-produced enzyme inhibitor HDX (200 μM) [31]. In order to verify whether SO2 activates autophagy by inhibiting the PI3K/AKT pathway, the HG + SO2 + 740 Y-P group was incubated with PI3K/AKT activator 740 Y-P (30 μM) after the SO2 pretreatment, and all groups were incubated with high D-glucose medium (33 mM), except for the Control group and the SO2 control group.
H9c2 cardiomyocyte apoptosis was detected using AV-FITC/PI Apoptosis Detection Kit (Keygene Biotech Co., Ltd.). In accordance with the manufacturer’s instructions, the cells were digested with 0.25% EDTA-free trypsin (Gibco, Grand Island, NY, USA) and washed twice in cold phosphate buffer saline (PBS). Resuspension was performed with 500 μl binding buffer supplemented with 5 μl FITC and 5 μl PI for 10 min in a dark room. Flow cytometry (fluorescence-activated cell sorting [FACS] Calibur cytometer; BD Biosciences, San Diego, CA, USA) was adopted to obtain the apoptosis rate. AV-FITC values were set as the horizontal axis, and PI values were set as the vertical axis. All experiments were performed in triplicate.
Cells were fixed with 4% PFA for 40 min, permeabilized with 0.1% Triton X-100 for 5 min × 2, and blocked with 5% BSA for 1 h, incubated with rabbit anti-Beclin1 primary antibody (1:200) overnight at 4°C, then incubated with Cy3 (1:200)-conjugated secondary antibody for 1 h at room temperature and counterstained using DAPI. Fluorescence was analyzed using a fluorescence microscope (IX71; Olympus, Tokyo, Japan).
Total RNA was extracted from the rat myocardial tissues using TRIzol (Thermo Fisher Scientific, Rockford, IL, USA) and then transcribed into cDNA with the Prime-Script RT kit (Takara, Shiga, Japan). Real-time qPCR was performed with SYBR green (Takara) under the standard conditions of 95°C for 30 sec, 40 cycles of 95°C for 5 sec, and 60°C for 30 sec. Real-time qPCR was conducted under the standard conditions, GAPDH was used as an internal reference, and the relative expression levels of target genes were obtained using the 2-ΔΔCt method. The primer sequences are presented as follows:
Col3a1:
F: AAGGGCAGGGAACAACTGAT, R: GGTGAAGCAGGGTG AGAAGA;
P62:
F: GCTCGACCCGTCCTTCACTCA, R: CAGGGATCAGTA CCCGCTCT;
Caspase3:
F: TTAGAACTTGAATCCACGAG, R: TTCCAATAATAAAAC ACGACT;
Bax:
F: GCGATGAACTGGACAACAAC, R: AAAGTAGAAAAGGG CAACCAC.
GAPDH:
F: ACAGCAACAGGGTGGTGGAC, R: TTTGAGGGTGCAGC GAACTT
The rat myocardial tissues and the cell precipitates were lysed through radioimmunoprecipitation assay (RIPA) lysis buffer containing cold protease inhibitor, the supernatant was collected after centrifugation, and the protein concentration of the supernatant was quantified and leveled using the BCA protein quantification kit based on the manufacturer’s guidelines. The samples were denatured after heating at 95°C for 10 min, separated in 10%–12% polyacrylamide electrophoresis gels, and electrophoretically transferred to a PVDF membrane (polyvinylidene fluoride membrane; Millipore Co., Bedford, MA, USA). The membranes were blocked with 5% skim milk at RT for 1 h and treated with primary antibody at 4°C overnight. The membranes were washed three times (5 min × 3) with tris-buffered saline (TBST) containing 20 and incubated with the corresponding species of horseradish peroxidase (HRP)-conjugated secondary antibody at RT for 1 h. After TBST washing (5 min × 3), the exposure shots were taken with ECL chemiluminescent solution, and image signals were obtained using the Bio-Rad XRS+ imaging system (Bio-Rad, Hercules, CA, USA). The relative data were analyzed using ImageJ software (NIH, Bethesda, MD, USA).
The data were expressed as mean ± standard error (SEM). The statistical analysis was performed using GraphPad Prism 9.0 software (GraphPad Software Inc., San Diego, CA, USA). The differences between group means were evaluated through one-way ANOVA Test. p < 0.05 was considered statistically significant.
Tables 1 and 2 list the results of the glucose tolerance test and the values of fasting blood glucose, insulin and HOMA-IR of the rats in the respective group, respectively. The fasting blood glucose, insulin levels and HOMA-IR values of the rats in the DC group and the DC + SO2 group increased significantly compared with those of the Control group (p < 0.05), which suggested that the rat model of type II diabetes was successfully established. There were significant abnormalities of blood glucose and insulin in both groups. The fasting blood glucose, insulin levels and related HOMA-IR values in the DC + SO2 group tended to decrease compared with those of the DC group, whereas the difference between the two groups did not achieve statistical significance (p > 0.05). The fasting blood glucose, insulin level and HOMA-IR value of the rats in the SO2 group did not change significantly compared with those of the Control group (p > 0.05).
Table 1 . Test results of glucose tolerance test of the rats in the respective group.
Groups | Number | 0.5 h (mM) | 1 h (mM) | 2 h (mM) |
---|---|---|---|---|
Control | 9 | 5.57 ± 0.24 | 5.68 ± 0.37 | 4.27 ± 0.16 |
DC | 7 | 31.36 ± 0.62* | 31.09 ± 0.40* | 27.59 ± 1.34* |
DC + SO2 | 8 | 30.62 ± 1.53* | 30.63 ± 0.44* | 24.83 ± 1.12* |
SO2 | 9 | 6.94 ± 0.49 | 5.82 ± 0.89 | 5.54 ± 0.10 |
Values are presented as mean ± SD. SO2, sulfur dioxide; DC, diabetic cardiomyopathy. *p < 0.05
Table 2 . Comparison of values of fasting blood glucose, insulin and HOMA-IR of the rats in the respective group.
Groups | Number | Fasting blood glucose (mM) | Fasting insulin level (μlU/ml, 103) | HOMA-IR |
---|---|---|---|---|
Control | 9 | 3.70 ± 0.32 | 25.00 ± 10.00 | 4.00 ± 0.80 |
DC | 7 | 23.15 ± 1.49* | 436.67 ± 79.46* | 363.03 ± 68.61* |
DC + SO2 | 8 | 22.32 ± 1.27* | 316.67 ± 56.25* | 312.48 ± 58.59* |
SO2 | 9 | 3.60 ± 0.28 | 44.00 ± 5.48 | 7.00 ± 0.63 |
Values are presented as mean ± SD. HOMA-IR, homeostasis model assessment of insulin resistance; SO2, sulfur dioxide; DC, diabetic cardiomyopathy. *p < 0.05
Western blot was used to detect the changes in protein expression of SO2-generating enzyme AAT1/2 in the myocardial tissues of the rats in the respective group (Fig. 2A, C). As revealed by the results, compared with the Control group, the expression of AAT1/2 in the myocardial tissues of the rats in the DC group decreased significantly (p < 0.05), while the expression of AAT1/2 in the myocardial tissues of the rats in DC + SO2 group increased after the intervention of exogenous SO2 donor Na2SO3/NaHSO3 (p < 0.05). There was no statistically significant difference in the expression of AAT1/2 between the SO2 control group and the Control group.
Besides, similar changes were also identified in the cell experiments
In this paper, we detected the cardiac function and structural changes of the respective rats by echocardiography (Table 3), and found that compared with the Control group, the LVFS value of the DC group decreased, while the LVFS value of the DC + SO2 group increased after SO2 intervention. However, the difference between the groups was not statistically significant. By comparing the changes of HW/BW of the rats in the respective group, as listed in Table 4, we found that the HW/BW of the DC group was significantly higher than that of the Control group (p < 0.05). However, after SO2 intervention, the HW/BW of the DC + SO2 group decreased; the difference was not statistically significant.
Table 3 . Cardiac LVFS values of the rats in the respective group.
Groups | Number | LVEDD (mm) | LVESD (mm) | LVFS |
---|---|---|---|---|
Control | 9 | 5.53 ± 0.31 | 3.30 ± 0.15 | 39.97 ± 2.03 |
DC | 7 | 4.94 ± 0.19 | 3.35 ± 0.10 | 31.96 ± 2.35 |
DC + SO2 | 8 | 5.02 ± 0.24 | 3.07 ± 0.10 | 38.26 ± 3.45 |
SO2 | 9 | 4.96 ± 0.20 | 2.97 ± 0.05 | 39.83 ± 1.91 |
Values are presented as mean ± SD. LVFS, left ventricular fractional shortening; LVEDD, left ventricular end-diastolic-dimension; LVESD, left ventricular end-systolic dimension; SO2, sulfur dioxide; DC, diabetic cardiomyopathy.
Table 4 . The HW, BW and HW/BW values of the rats in the respective group.
Groups | Number | BW (g) | HW (mg) | HW/BW (10–3) |
---|---|---|---|---|
Control | 9 | 390.00 ± 2.58 | 1090.00 ± 93.63 | 2.79 ± 0.17 |
DC | 7 | 236.25 ± 19.70 | 810.50 ± 47.50 | 3.48 ± 0.09* |
DC + SO2 | 8 | 285.83 ± 24.13 | 914.67 ± 85.39 | 3.20 ± 0.11 |
SO2 | 9 | 400.00 ± 25.49 | 1017.20 ± 45.26 | 2.55 ± 0.09 |
Values are presented as mean ± SD. LVFS, left ventricular fractional shortening; SO2, sulfur dioxide; DC, diabetic cardiomyopathy; BW, body weight; HW, heart weight. *p < 0.05
As revealed by the result of Masson staining (Fig. 3A, B), compared with the control group, the blue-stained collagen fibers in the myocardial tissue of the diabetic rats in the DC group were significantly increased by about 4 times, and the myocardial fibers were disordered. However, after the intervention of exogenous SO2, the number of blue-stained collagen fibers in the myocardial tissue of rats decreased by about 1/2 compared with the DC group (p < 0.05), and the myocardial cells were arranged relatively neatly. Moreover, the expression changes of fibrosis-associated proteins (including Collagen III, MMP3, MMP8, and MMP13) were detected through Western blot (Fig. 3C, D). It was found that the expression of Collagen III, MMP3, MMP8, and MMP13 in the DC group was significantly higher than those in the Control group (p < 0.05). As revealed by the RT-qPCR results (Fig. 3E), the mRNA expression of Col3a1 in the DC group was about 3.8 times higher than that in the Control group; after the SO2 intervention, the changing trend of the above fibrosis-associated proteins was significantly reversed (p < 0.05). However, no statistically significant difference was found between the Control and SO2 groups. The above results indicated that there was obvious myocardial fibrosis in type II diabetes rats, and SO2 intervention could ameliorate myocardial fibrosis in diabetic rats.
In this paper, we observed the effect of high glucose on the apoptosis of H9c2 cardiomyocytes and the protective effect of SO2. Flow cytometry was used to detect the apoptosis rate of cells in each group (Fig. 4A). It was found that the apoptosis of H9c2 cardiomyocytes in the HG group increased by about 4.5 times compared with the control group under high-glucose stimulation. The incidence of early and late apoptotic cells was significantly increased (p < 0.05). After the intervention of exogenous SO2, the apoptosis rate of cardiomyocytes in the HG + SO2 group decreased by about 1/2, and the late apoptotic cells decreased significantly (p < 0.05). At the same time, the apoptosis-associated proteins were detected through Western blot (Fig. 4B–F): Bax/Bcl2, Cleaved Caspase3/Caspase3, Cleaved Caspase9/Caspase9 in the HG group were significantly higher than those in Control group (p < 0.05). After SO2 intervention, the above apoptotic proteins were significantly down-regulated (p < 0.05), and HDX could significantly reverse the anti-apoptotic effect of SO2. The expressions of Bax/Bcl2, Cleaved Caspase3/Caspase3, and Cleaved Caspase9/Caspase9 in cardiomyocytes of the HG + SO2 + HDX group were up-regulated (p < 0.05). The above results suggest that the high-glucose environment can induce the apoptosis of H9c2 cardiomyocytes, while SO2 intervention can reduce the apoptosis of cardiomyocytes induced by high-glucose stimulation.
Similar changes were observed in
The expression of autophagy-associated proteins in the myocardial tissue of the rats in the respective group was observed through Western blot. As revealed by the results (Fig. 6B, C), the expressions of Atg5, Atg16L1, LC3II/I, and Beclin1 in the myocardial tissue of the DC group were significantly lower than those of the Control group (p < 0.05). While the expression of P62 was significantly up-regulated (p < 0.05), and the above protein changes were reversed (p < 0.05) after SO2 intervention. RT-qPCR results showed that the expression level of P62 in the DC group was about 3.5 times higher than that in the Control group (Fig. 6G), and this change could be down-regulated after SO2 intervention. Moreover, it was found through transmission electron microscopy (Fig. 6A) that compared with the control group, the myocardial tissues of the DC group were characterized by vacuolized autophagosomes, fewer autophagosomes, swollen mitochondria, and disordered arrangement of muscle fibers. Besides, the number of autophagosomes in the myocardial tissue of the rats after SO2 intervention increased, vacuolization was rarely observed, and the arrangement of muscle fibers was relatively neat. The changes in autophagy-associated protein expression in the respective group of H9c2 cardiomyocytes were examined through Western Blot and immunofluorescence
In this paper, the changes in PI3K/AKT protein expression in the myocardial tissue of the rats in the respective group were observed through Western blot (Fig. 7A, C). As revealed by the results, compared with the Control group, the expressions of P-PI3K and P-AKT proteins in the DC group were significantly up-regulated (p < 0.05), and the ratios of P-PI3K/PI3K and P-AKT/AKT were also significantly increased. After SO2 intervention, the expressions of P-PI3K and P-AKT proteins in the myocardium of the rats in the DC + SO2 group were down-regulated (p < 0.05), and the ratios of P-PI3K/PI3K and P-AKT/AKT were decreased. There was no significant difference in the expression of P-PI3K and P-AKT between the SO2 control group and the Control group (p > 0.05).
The results of the
Type II diabetes is a metabolic disease characterized by hyperglycemia and insulin resistance. It has been recognized as a vital public health problem worldwide and has posed a serious hazard to people’s health and quality of life [32-34]. Cardiomyopathy damage caused by diabetes has been found as one of the main causes of death in type II diabetes patients. Diabetic cardiomyopathy refers to a major cardiovascular disease that is characterized by myocardial abnormalities due to diabetes. Hyperglycemia and insulin resistance, two independent risk factors for DC, can cause abnormal myocardial metabolism and dysfunction and gradually develop into heart failure with the progression of the disease [35,36]. Existing studies have suggested that tissue inflammation, oxidative stress, and dysregulation of autophagy induced by high-glucose stimulation can promote dysfunction of cardiomyocytes and fibrosis of the myocardial interstitium, thus leading to diabetic cardiomyopathy [37,38]. Myocardial fibrosis is a vital pathological change leading to diabetic cardiomyopathy, which is primarily manifested as myocardial pathological changes characterized by excessive deposition of myocardial extracellular matrix and myocardial structural disorder; it can develop into heart failure [39-41]. In this experiment, a model of rats with type II diabetes was established by a diet high in fat and sugar and through the intraperitoneal injection of STZ. The results of Masson staining showed that the DC group formed more collagen fibers than the normal group. Besides, the ultrasound results indicated that the cardiac function was lower than that of the normal group, thus revealing that myocardial fibrosis could cause obvious myocardial fibrosis and cardiac dysfunction in diabetic rats.
Apoptosis has been found as a key link between myocardial fibrosis and myocardial remodeling [42]. Since cardiomyocytes are permanent cells, it is difficult to repair and rebuild through proliferation and differentiation after myocardial injury, and effectively antagonizing cardiomyocyte apoptosis will help to improve myocardial fibrosis and inhibit myocardial remodeling [43]. The experimental result showed that the number of positive cells in the myocardium of diabetic rats after TUNEL staining increased significantly, and the pro-apoptotic protein in the myocardial tissue was significantly up-regulated compared with the Control group. The result of the
Autophagy means that cells engulf their own damaged organelles or proteins and fuse with lysosomes to meet the renewal and metabolic needs of the organelles of cells. Moderate autophagy is an important self-protection mechanism of damaged cells under stress [45], which helps maintain cellular physiological homeostasis. Insufficient autophagy may lead to the dysfunction of cardiomyocyte self-repair, which in turn leads to cardiomyocyte injury and even induces apoptosis [46]. Previous studies have suggested that autophagy is one of the important causes of diabetic cardiomyopathy. Autophagy-dependent cell death leads to the loss of cardiomyocytes and initiates the repair program of fibrosis, which is an important factor in the occurrence of diabetic cardiomyopathy [47]. However, recent studies have found that moderate autophagy can antagonize cellular inflammation, mitochondrial stress, oxidative stress, etc., thereby inhibiting cardiomyocyte apoptosis [48]. Dewanjee
The PI3K/Akt pathway has been found as a main regulatory pathway of autophagy. Existing studies have suggested that down-regulating the expression of the PI3K/AKT pathway can reduce diabetes-induced cardiac dysfunction and ameliorate myocardial fibrosis [24]. Its mechanism may be correlated with the inhibition of collagen synthesis in cardiac fibroblasts and cardiomyocyte hypertrophy [51]. Over-activation of the PI3K/AKT pathway can induce apoptosis, while down-regulation of PI3K/AKT can inhibit cardiomyocyte apoptosis and improve myocardial fibrosis [23], but the specific mechanism is still unclear. It has been found that inhibiting the excessive activation of PI3K/AKT can restore or upregulate the impaired autophagic flux and antagonize cardiomyocyte apoptosis [20].
SO2 was considered a harmful gas molecule in the past. With further research on endogenous SO2, the physiological protective effect of SO2 in the body has been gradually revealed. SO2 has been considered the fourth endogenous gas signal molecule newly discovered after NO, CO, and H2S. It exhibits the functions of vasodilator, anti-oxidation, anti-inflammatory, inhibition of apoptosis, and smooth muscle proliferation while having an important protective effect on the cardiovascular system at a proper concentration [30,53-55]. However, the correlation between SO2 and myocardial fibrosis and remodeling remains unclear, and the internal regulatory mechanism is unknown [56]. The endogenous enzyme AAT of SO2 is widely expressed in tissues and organs, and it has the highest expression level in the myocardium. As an important endogenous regulator of cardiovascular homeostasis, exogenous SO2 donors can upregulate the expression of endogenous SO2-producing enzyme AAT1, enhancing the synthesis of endogenous sulfur dioxide and inhibiting cardiomyocyte apoptosis, reducing inflammatory damage mediated by the NLRP3 inflammasome body and improve cardiac function [29]. We have previously found that exogenous SO2 donors can upregulate the expression of GOT1/AAT1 increasing the synthesis of endogenous sulfur dioxide and improving myocardial fibrosis in rats with type 1 diabetes, and is related to the inhibition of cardiomyocyte apoptosis [26], but the internal regulatory mechanism is not very clear. In addition, some scholars have found that SO2 can also inhibit endoplasmic reticulum stress and improve myocardial fibrosis [57], while it can inhibit the proliferation and migration of fibroblasts [27]. Therefore, some scholars regard endogenous SO2 as a potential and promising anti-fibrotic treatment strategy, but the specific mechanism of action is unclear and needs to be further explored [25]. In this study, it was found that endogenous SO2-producing enzyme AAT1/2 in myocardial tissue of diabetic rats and H9c2 cardiomyocytes stimulated by high glucose decreased significantly, suggesting that the production of endogenous SO2 in cardiomyocytes of diabetic rats was insufficient. At the same time, it was found in the study that administration of exogenous SO2 donor can improve the deposition of collagen fibers in the myocardial interstitium of diabetic rats, while the level of damaged autophagy is significantly up-regulated, and the apoptosis of cardiomyocytes is significantly antagonized. The study also found that the above changes may be related to the excessive activation of the PI3K/AKT pathway antagonized by SO2. To investigate whether SO2 regulates autophagy and inhibits cardiomyocyte apoptosis
In brief, this paper found that SO2, a novel gas signaling molecule, could inhibit cardiomyocyte apoptosis by activating autophagy, thus improving myocardial fibrosis and myocardial remodeling in diabetic rats. Moreover, the mechanism might be correlated with the excessive activation of the PI3K/AKT pathway that it antagonized. This study shows that endogenous SO2 might play an important protective role in the occurrence and development of myocardial fibrosis in type 2 diabetes. Likewise, the down-regulation of endogenous SO2 might play a certain role in the mechanism of myocardial remodeling, and the PI3K/AKT-mediated autophagy and its secondary myocardial apoptosis might be an essential link. This paper is expected to discover novel intervention targets for myocardial remodeling and heart failure, and more specific mechanisms (e.g., the mechanism by which SO2 regulates PI3K/AKT phosphorylation) should be studied in depth.
None.
This project was supported by the National Natural Science Foundation of China (No. 81870230 and No.82074236), Clinical Major Projects of Hunan Provincial Health Commission (No. 20201913), the Natural Science Foundation of Hunan Province (No.2021JJ70035, No. 2021JJ40499 and No. 2021JJ70116), and Longhua district - level research projects of Shenzhen (No. 2020035).
The authors declare no conflicts of interest.
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
ⓒ 2019. The Korean Journal of Physiology & Pharmacology. Powered by INFOrang Co., Ltd