pISSN 1226-4512 eISSN 2093-3827

Article

home Article View

Original Article

Korean J Physiol Pharmacol 2020; 24(6): 473-479

Published online November 1, 2020 https://doi.org/10.4196/kjpp.2020.24.6.473

Copyright © Korean J Physiol Pharmacol.

2,3,5,4’-Tetrahydroxystilbene-2-O-β-D-Glucoside modulated human umbilical vein endothelial cells injury under oxidative stress

Yan Guo1,2,#, Wenxue Fan2,#, Shuyu Cao2, Yuefeng Xie2, Jiancong Hong2, Huifen Zhou2, Haitong Wan2, and Bo Jin2,*

1College of Basic Medicine & Public Health, 2College of Life Science, Zhejiang Chinese Medical University, Hangzhou, Zhejiang 310053, China

Correspondence to:Bo Jin
E-mail: jinbo@zcmu.edu.cn
#These authors contributed equally to this work.

Received: April 22, 2020; Revised: July 24, 2020; Accepted: July 27, 2020

This is an Open Access journal distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Endothelial cell injury is a major contributor to cardiovascular diseases. The 2,3,5,4’-Tetrahydroxystilbene-2-O-β-D-Glucoside (TSG) contributes to alleviate human umbilical vein endothelial cells (HUVECs) injury through mechanisms still know a little. This study aims to clarify the TSG effects on gene expression (mRNA and microRNA) related to oxidative stress and endoplasmic reticulum stress induced by H2O2 in HUVECs. We found that TSG significantly reduced the death rate of cells and increased intracellular superoxide dismutase activity. At qRT-PCR, experimental data showed that TSG significantly counteracted the expressions of miR-9-5p, miR-16, miR-21, miR-29b, miR-145-5p, and miR-204-5p. Besides, TSG prevented the expression of ATF6 and CHOP increasing. In contrast, TSG promoted the expression of E2F1. In conclusion, our results point to the obvious protective effect of TSG on HUVECs injury induced by H2O2, and the mechanism may through miR16/ATF6/ E2F1 signaling pathway.

Keywords: Endoplasmic reticulum stress, Human umbilical vein endothelial cells, MicroRNAs, Oxidative damage, 2,3,5,4’-Tetrahydroxystilbene-2-O-β-D-Glucoside

Cardiovascular diseases (CVD) are the leading cause of death worldwide [1]. Vascular endothelial dysfunction is a crucial factor in the occurrence of CVD. And oxidative stress is considered to be endothelial dysfunction major inducer. In particular, oxidative stress caused by ROS is a critical factor in the pathogenesis of vascular diseases. Thus, identifying more effective antioxidants is a promising strategy to prevent endothelial cell injury, which is of great significance for the prevention, clinical diagnosis, and monitoring of endothelial dysfunction and adverse events of CVD [2].

Antioxidant agents that attenuate the oxidative stress may have therapeutic applications in reducing endothelial cell damage. Many plant constituents exhibit antioxidant activity. For sample, Wu et al. [3] showed that the Polygonum orientale flower extract can protect human umbilical vein endothelial cells (HUVECs) from hydrogen peroxide (H2O2)-triggered oxidative damage by enhancing the activity of antioxidant enzymes, such as superoxide dismutase (SOD) and catalase. 2,3,5,4’-Tetrahydroxystilbene-2-O-β-D-Glucoside (TSG), the characteristic water-soluble component of Polygonum multiflorum Thunb, has shown various pharmacologic activities, including antioxidant, anti-inflammatory, anti-aging, and anti-atherosclerotic effects [4-6]. Neuroprotective effects of TSG against glutamate or H2O2-induced oxidative toxicity were confirmed between cell lines or rodent models [7,8]. Li et al. [9] confirmed that TSG decreased pulmonary aortic endothelial cell inflammatory injury induce by septic-serum via the ROS/MAPK/NF-κB signaling pathway. However, the protective effect of TSG on H2O2-induced oxidative damage remains to be fully elucidated.

H2O2 acts as a signal molecule and second messenger involved in most of the redox metabolism reactions and processes of the cells, and is widely used to establish oxidative stress model [10]. Thus, stimulation with H2O2 is a good strategy for investigating vascular endothelial damage. In this study, we aimed to clarify the TSG effects on gene expression (mRNA and microRNA) related to oxidative stress induced by H2O2 in HUVECs.

Materials

HUVECs cell line was purchased from Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). 2,3,5,4'-tetrahydroxystilbene-2-O-β-D-glucoside (TSG, CAS Number: 82373-94-2, purity: ≥ 98%) and TSG was dissolved in sterile water.

Cell cultures and cell treatment

The cells were cultured in RPMI 1640 with 10% fetal bovine serum. The medium was changed every 2 days and the cells were passaged with trypsin-EDTA. HUVECs were randomly divided into 4 groups: control group, H2O2 group, TSG (20 μg/ml) group and TSG (40 μg/ml) group. Cells in the control group were incubated with normal growth conditions. Those in the H2O2 group were incubated with H2O2 (200 μM) for 2 h and then recovered for 24 h. In the TSG (20 μg/ml, 40 μg/ml) groups, the cells were cultured with the medium containing different concentrations of TSG for 24 h before they were treated same as H2O2 group.

MTS assay

The MTS assay was used to assess cell viability. Before each experiment, HUVECs (5 × 103 cells/well) were seeded in 96-well microtiter plates, and cells were treated with H2O2 or TSG according to the different experimental purposes. Subsequently, 20 μl MTS solution was added to each well, and the plates were incubated for 2 h. The absorbance was measured at 490 nm and used to calculate the relative ratio of cell viability.

In situ fluorescence detection of apoptosis

An annexin V-FITC apoptosis detection kit (MultiSciences; LiankeBio, Hangzhou, China) was used for the dual staining assay. Briefly, cells were harvested and washed with PBS. After adding the staining solution per the requirements of the kit, incubate with aluminum foil paper at room temperature for 15 min in the dark, and then place them in an ice bath in the dark. Then observed under a fluorescence microscope within one hour, Annexin V-FITC showed green fluorescence and propidium iodide (PI) showed red fluorescence.

Detection of SOD

We used Total Superoxide Dismutase Assay Kit with WST-8 (Beyotime Biotechnology, Shanghai, China) to detect the SOD activity in cell lysates. After treatments, cell lysates were prepared, and the protein concentration was measured using the BCA assay (Beyotime Biotechnology). The SOD activity levels were quantified according to the manufacturer’s instructions.

RNA isolation and quantitative PCR (qRT-PCR)

Total RNA was extracted with TRIzol reagent. The complementary DNA was synthesized using Prime Script TM RT Master Mix (Perfect Real Time) (Takara, Dalian, China) for real-time polymerase chain reaction (RT-PCR) with conditions of 37°C for 15 min, 85°C for 5 sec, and storage at 4°C. The RT-PCR was performed in duplicate using SYBR®Prime Ex Taq TM II (Tli RNaseH Plus) (Takara) at 95°C for 10 sec, and then 95°C for 5 sec, 60°C for 20 sec for 40 cycles, and 95°C for 1 min, 55°C for 30 sec, 95°C for 30 sec. The primer sequences used in this study were as Table 1 showed.

Table 1 . The primer sequences.

NameForward primerReverse primer
GAPDHGGCATGGGTCAGAAGGATTCCATGTCACGCACGATTTCCCGC
E2F1GTTTCCAGAGATGCTCACCTTGTCACACCACACAGACTCCTTCCCTT
ATF4TTTGACAGCTAAAGTGAAGACTGAGCTTCTTCTGGCGGTACCTA
ATF6AATGCCAGTGTCCCAGCAAGCGCAGGCTGTATGCTGA
CHOPACTCTCCAGATTCCAGTCAGAGGCCTCTACTTCCCTGGTCAG
GRP78TGGGAGGAGTCATGACAAAAGGGGTCGTTCACCTTCATAG
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT
miR-9CGGAGATCTTTTCTCTCTTCCAAGAATTCGCCCGAACCAG
miR-16TAGCAGCACGTAAATATTGGCGCCTCTGACTGGGAATTGTGAC
miR-21ACACTCCAGCTGGGTAGCTTATCAGACTGATGCTCAACTGGTGTCGTGGA
miR-145CGGAATTCAAGGTCACTAGAGCCTGGGAACCGCGGATCCTTCAACCACTGTGTCTTGAGAC
miR-204-5PGCGAGCACAGAATTAATACGCTCAGTGCACTACAGAACTTTGT
miR-29bTTCACAGTGGCTAAGTTCCGC


TargetScanHuman database

TargetScanHuman database is a miRNA target gene prediction website for human. We inputed the effective miRNA based on the results of qRT-PCR to predict possible target genes.

Statistical analysis

GraphPad Prism 5 software was used for statistical analysis. Measurement data were compared using a one-way analysis of variance. p < 0.05 was considered statistically significant.

H2O2 exposure induced the decrease of cell viability

To examine the cytotoxicity of H2O2 on HUVECs, cell viability was detected by the MTS assay. As shown in Fig. 1, treatment with H2O2 (60 μM, 80 μM, and 100 μM) for 12 h had no effect on cell viability of HUVECs. However, cell viability of HUVECs decreased when the concentration of H2O2 increased to 200 μM. Therefore, the concentrations of 200 μM were chosen for H2O2, respectively, for the subsequent experiments.

Figure 1. H2O2 exposure induced the decrease of cell viability. HUVECs stimulated with or without on by H2O2. Values are expressed as mean ± standard deviation (n = 3). HUVECs, human umbilical vein endothelial cells. ##p < 0.01 vs. control.

TSG pre-treatment improved cell viability

TSG treatment at the concentrations of 120 μg/ml, 100 μg/ml, 80 μg/ml, 60 μg/ml, 40 μg/ml, and 20 μg/ml showed no cytotoxicity on HUVECs when compared with the control group (Fig. 2A). Furthermore, the decreased cell viability of HUVECs induced by H2O2 was improved with TSG treatment (40 μg/ml and 20 μg/ml), suggesting that TSG rescued H2O2-induced cell injury in HUVECs (Fig. 2B).

Figure 2. TSG pre-treatment improved cell viability. TSG Treatment on HUVECs untreated (basal) (A) and H2O2-induced (B) for 24 h. Values are expressed as mean ± standard deviation (n = 3). TSG, 2,3,5,4’-Tetrahydroxystilbene-2-O-β-D-Glucoside; HUVECs, human umbilical vein endothelial cells. #p < 0.05 and ##p < 0.05 vs. control; *p < 0.05 and **p < 0.05 vs. H2O2 group.

TSG pre-treatment suppressed apoptotic cell death

Cell death (annexin-V/PI) was explored in HUVECs treated 24 h with TSG in the presence or absence of H2O2 (200 µM). H2O2 can induce various cell death, including apoptosis and necrosis. We measured the Annexin V positive and PI positive HUVECs of each group to determine the state of the cells. As shown in Fig. 3, the treatment of HUVECs with 200 μM H2O2 significantly increased the apoptotic cell death. And pre-incubation with TSG significantly attenuated H2O2-induced apoptotic cell death.

Figure 3. TSG pre-treatment suppressed apoptotic cell death. Representative images of staining with Annexin V-FITC (green) and PI (red) acquired using a laser scanning microscope (scale ×100 μm). The images were captured within the same field and then merged. Values are expressed as mean ± standard deviation (n = 3). TSG, 2,3,5,4’-tetrahydroxystilbene-2-O-β-D-glucoside; PI, propidium iodide.

TSG pre-treatment ameliorated H2O2 induced loss of SOD in HUVECs

SOD is an important metal enzyme that can specifically remove superoxide anions and protect the human body from oxidative damage. Moreover, SOD is a key mitochondrial antioxidant. We measured the intracellular SOD activity of each group to determine the extent of their oxidative damage. The result of the antioxidant system of SOD was shown in Fig. 4. The activity of SOD significantly decreased in H2O2-treated group compared with that in the control group, and was significantly actived by TSG pre-treatment with increasing concentrations.

Figure 4. TSG pre-treatment ameliorated H2O2 induced loss of SOD in HUVECs. SOD activity was been detected. Values are expressed as mean ± standard deviation (n = 3). TSG, 2,3,5,4’-tetrahydroxystilbene-2-O-β-D-glucoside; SOD, superoxide dismutase; HUVECs, human umbilical vein endothelial cells. #p < 0.05 vs. control; *p < 0.05 vs. H2O2 group.

Effect of TSG pre-treatment in miRNA expression in H2O2 induced HUVECs

Studies have shown that miRNA can regulate the expression of most genes in cells. In the H2O2-treated HUVECs, the expression of miR-9-5p, miR-16, miR-21, miR-29b, miR-145-5p, and miR-204-5p were significantly upregulated. TSG antagonized H2O2-induced miR-9-5p, miR-16, miR-21, miR-29b, miR-145-5p, and miR-204-5p synthesis (Fig. 5A–F).

Figure 5. Effect of TSG pre-treatment in miRNA expression in H2O2 induced HUVECs. qRT-PCR was used to detected the (A) miR-9-5p, (B) miR-16, (C) miR-21, (D) miR-29b, (E) miR-145-5p, and (F) miR-204-5p synthesis. Values are expressed as mean ± standard deviation (n = 3). TSG, 2,3,5,4’-tetrahydroxystilbene-2-O-β-D-glucoside; HUVECs, human umbilical vein endothelial cells. #p < 0.05 and ##p < 0.01 vs. control; *p < 0.05 and **p < 0.01 vs. H2O2 group.

Effect of TSG on endoplasmic reticulum (ER) stress in HUVECs

The ER has recently emerged as an alternative target to induce cell death, because prolonged ER stress results in the induction of apoptosis. The levels of ER stress markers (ATF4, ATF6, CHOP, GRP78) and E2F1 mRNA were examined with qRT-PCR. In the H2O2-treated HUVECs, the expression of ATF6 and CHOP mRNA was significantly upregulated while the ATF4, GRP78 and E2F1 mRNA were significantly downregulated. TSG antagonized H2O2-induced ATF6, CHOP and E2F1 mRNA synthesis. However, TSG has no effects on reversing the expression of ATF4 and GRP78 mRNA (Fig. 6A–E).

Figure 6. Effect of TSG on ER stress in HUVECs. qRT-PCR was used to detect the (A) ATF4, (B) ATF6, (C) CHOP, (D) GRP78, and (E) E2F1 mRNA synthesis. Values are expressed as mean ± standard deviation (n = 3). TSG, 2,3,5,4’-tetrahydroxystilbene-2-O-β-D-glucoside; ER, endoplasmic reticulum; HUVECs, human umbilical vein endothelial cells. #p < 0.05 and ##p < 0.01 vs. control; *p < 0.05 and **p < 0.01 vs. H2O2 group.

CVD are major contributor to death associated with endothelial dysfunction. Effective drugs to prevent endothelial dysfunction are important. In the present research, our results showed that TSG could mitigate H2O2-induced decrease of cell vitalities and antioxidative enzyme activities and decrease the level of oxidative stress and ER stress in HUVECs. And the safety of TSG has been well proved. Our result showed that TSG at the concentration had no effect on the cell viabilities of HUVECs. Notably, the concentration of 40 μg/ml and 20 μg/ml showed a property to inhibit H2O2-induced oxidative stress and ER stress.

SOD is an important metal enzyme that can specifically remove superoxide anions and protect the human body from oxidative damage. It is closely related to the occurrence and development of many diseases. After we measured the total SOD activity in cells, we found that TSG can reduce the oxidative damage of H2O2-induced HUVECs by increasing the SOD activity in cells. In addition, the results of in situ fluorescence detection of apoptosis also visually show that TSG significantly inhibits H2O2-induced HUVECs apoptotic cell death.

miRNAs are small endogenous non-coding RNAs of 18–24 nucleotides in length, which are widely present in plants and animals and are involved in various biochemical regulations of the body, including cell proliferation, senescence, death, cell cycle regulation and apoptosis [11-13]. For example, studies have investigated the role of miR-9-5p in angiogenesis and apoptosis in HUVECs injury, and dual luciferase reporter gene assay verified that miR-9-5p targeted CXCR4 [14], while miR-16, miR-29b exerts a specific tumor suppressive effect by targeting the oncogene Bcl-2 [15,16]. As a key regulator of apoptosis in many types of human tumors, Bcl-2 is also positively regulated by miR-21 [17]. In addition, miR-145 has a negative regulatory effect on caspase-3 and inhibits the apoptosis process of cells [18]. Moreover, studies have shown that HUVECs were suppressed by conditioned media from lung cancer cells with miR-204 overexpression [19]. Based on the above research, we explored whether TSG has effects on the expressions of miRNAs in H2O2-induced HUVECs. And the results showed that TSG can play a protective role against HUVECs oxidative damage via reducing the expression of miR-9-5p, miR-16, miR-21, miR-29b, miR-145-5p and miR-204-5p. These may also prompt us to further study the antioxidant mechanism of TSG in the future consider miR-9-5p, miR-16, miR-21, miR-29b, miR-145-5p, and miR-204-5p.

ER stress occurs after oxidative stress. ER represents a compartment able to sense several cellular stresses and to trigger, as last resort, cell death [20]. ER stress markers included the ATF4, ATF6, CHOP, and GRP78. ATF4/ATF6 [21,22] which activates transcription factor (ATF/CREB) family, molecular chaperone GRP78 in the endoplasmic reticulum, and CHOP, a transcription factor that mediates endoplasmic reticulum stress-induced apoptosis [23], P53 [5], etc. have an important relationship with oxidative stress and apoptosis. Our results showed that TSG may exert its protective effect against HUVECs oxidative damage via decreasing the expressions of ATF6 and CHOP. TSG had little effects on the expression of ATF4 and GRP78. Meanwhile, we made use of the TargetScanHuman database to find that ATF6 may be the target gene of miR-16 (Fig. 7).

Figure 7. The predicted result of TargetScanHuman database.

E2F1 is known to exert different effects on cell growth and apoptosis depending on the cell context. ER stress-mediated E2F1 down-regulation may contribute to the life/death cell decision under prolonged ER stress. Our results indicated that the low expression of E2F1 will promote HUVECs oxidative damage, while TSG can play its protective role against HUVECs oxidative damage via increasing the expression of E2F1. Pagliarini et al. [24] demonstrated that ATF6 controls the expression of E2F1 during the UPR program execution through direct binding to an ERSE site within the E2F1 gene promoter. Therefore, we could hypothesis that TSG regulate the expression of E2F1 through ATF6.

In summary, TSG can effectively protect HUVECs from oxidative damage induced by H2O2. Its main regulatory mechanism may be related to miR16/ATF6/E2F1 signaling pathway. And the molecular mechanism of its specific role remains to be further explored.

This work was supported by the Natural Science Foundation of Zhejiang Province, China (LY17H280007).

B.J. jointly conceived and designed the study with H.T.W.; Y.G., S.Y.C., and W.X.F. performed experiments; Y.G., Y.F.X., and J.C.H. analyzed the data; H.F.Z. and Y.G. drafted the manuscript; B.J. and H.T.W. revisited the manuscript critically for important intellectual content. All authors contributed equally to this work.

  1. Ueda P, Woodward M, Lu Y, Hajifathalian K, Al-Wotayan R, Aguilar-Salinas CA, Ahmadvand A, Azizi F, Bentham J, Cifkova R, Di Cesare M, Eriksen L, Farzadfar F, Ferguson TS, Ikeda N, Khalili D, Khang YH, Lanska V, León-Muñoz L, Magliano DJ, et al. Laboratory-based and office-based risk scores and charts to predict 10-year risk of cardiovascular disease in 182 countries: a pooled analysis of prospective cohorts and health surveys. Lancet Diabetes Endocrinol. 2017;5:196-213.
    Pubmed KoreaMed CrossRef
  2. Scioli MG, Storti G, D'Amico F, Rodríguez Guzmán R, Centofanti F, Doldo E, Céspedes Miranda EM, Orlandi A. Oxidative stress and new pathogenetic mechanisms in endothelial dysfunction: potential diagnostic biomarkers and therapeutic targets. J Clin Med. 2020;9:1995.
    Pubmed KoreaMed CrossRef
  3. Wu Q, Liu XX, Lu DY, Li YT, Sun J, Lan YY, Liu T. [Protective effect of Polygonum orientale flower extract on H₂O₂-induced oxidative damage of HUVEC cells]. Zhongguo Zhong Yao Za Zhi. 2018;43:1008-1013; Chinese.
    Pubmed CrossRef
  4. Büchter C, Zhao L, Havermann S, Honnen S, Fritz G, Proksch P, Wätjen W. TSG (2,3,5,4'-Tetrahydroxystilbene-2-O-β-D-glucoside) from the Chinese herb Polygonum multiflorum increases life span and stress resistance of Caenorhabditis elegans. Oxid Med Cell Longev. 2015;2015:124357.
    Pubmed KoreaMed CrossRef
  5. Zhao J, Liang Y, Song F, Xu S, Nian L, Zhou X, Wang S. TSG attenuates LPC-induced endothelial cells inflammatory damage through notch signaling inhibition. IUBMB Life. 2016;68:37-50.
    Pubmed CrossRef
  6. Zhao J, Xu S, Song F, Nian L, Zhou X, Wang S. 2,3,5,4'-tetrahydroxystilbene-2-O-β-D-glucoside protects human umbilical vein endothelial cells against lysophosphatidylcholine-induced apoptosis by upregulating superoxide dismutase and glutathione peroxidase. IUBMB Life. 2014;66:711-722.
    Pubmed CrossRef
  7. Lee SY, Ahn SM, Wang Z, Choi YW, Shin HK, Choi BT. Neuroprotective effects of 2,3,5,4'-tetrahydoxystilbene-2-O-β-D-glucoside from Polygonum multiflorum against glutamate-induced oxidative toxicity in HT22 cells. J Ethnopharmacol. 2017;195:64-70.
    Pubmed CrossRef
  8. Xie M, Zhang G, Yin W, Hei XX, Liu T. Cognitive enhancing and antioxidant effects of tetrahydroxystilbene glucoside in Aβ1-42-induced neurodegeneration in mice. J Integr Neurosci. 2018;17:355-365.
    Pubmed CrossRef
  9. Li W, Sun R, Zhou S, Ma J, Xie Y, Xu B, Long H, Luo K, Fang K. 2,3,5,4'-Tetrahydroxystilbene-2-O-β-D-glucoside inhibits septic serum-induced inflammatory injury via interfering with the ROS-MAPK-NF-κB signaling pathway in pulmonary aortic endothelial cells. Int J Mol Med. 2018;41:1643-1650.
    CrossRef
  10. Di Marzo N, Chisci E, Giovannoni R. The role of hydrogen peroxide in redox-dependent signaling: homeostatic and pathological responses in mammalian cells. Cells. 2018;7:156.
    Pubmed KoreaMed CrossRef
  11. Kuosmanen SM, Kansanen E, Sihvola V, Levonen AL. MicroRNA profiling reveals distinct profiles for tissue-derived and cultured endothelial cells. Sci Rep. 2017;7:10943.
    Pubmed KoreaMed CrossRef
  12. Incalza MA, D'Oria R, Natalicchio A, Perrini S, Laviola L, Giorgino F. Oxidative stress and reactive oxygen species in endothelial dysfunction associated with cardiovascular and metabolic diseases. Vascul Pharmacol. 2018;100:1-19.
    Pubmed CrossRef
  13. Nemecz M, Alexandru N, Tanko G, Georgescu A. Role of microRNA in endothelial dysfunction and hypertension. Curr Hypertens Rep. 2016;18:87.
    Pubmed KoreaMed CrossRef
  14. Yi J, Gao ZF. MicroRNA-9-5p promotes angiogenesis but inhibits apoptosis and inflammation of high glucose-induced injury in human umbilical vascular endothelial cells by targeting CXCR4. Int J Biol Macromol. 2019;130:1-9.
    Pubmed CrossRef
  15. Sun CY, She XM, Qin Y, Chu ZB, Chen L, Ai LS, Zhang L, Hu Y. miR-15a and miR-16 affect the angiogenesis of multiple myeloma by targeting VEGF. Carcinogenesis. 2013;34:426-435.
    Pubmed CrossRef
  16. Chung HJ, Choi YE, Kim ES, Han YH, Park MJ, Bae IH. miR-29b attenuates tumorigenicity and stemness maintenance in human glioblastoma multiforme by directly targeting BCL2L2. Oncotarget. 2015;6:18429-18444.
    Pubmed KoreaMed CrossRef
  17. Chao J, Guo Y, Li P, Chao L. Role of kallistatin treatment in aging and cancer by modulating miR-34a and miR-21 expression. Oxid Med Cell Longev. 2017;2017:5025610.
    Pubmed KoreaMed CrossRef
  18. Pan Y, Ye C, Tian Q, Yan S, Zeng X, Xiao C, Wang L, Wang H. miR-145 suppresses the proliferation, invasion and migration of NSCLC cells by regulating the BAX/BCL-2 ratio and the caspase-3 cascade. Oncol Lett. 2018;15:4337-4343.
    Pubmed KoreaMed CrossRef
  19. Liu X, Gao X, Zhang W, Zhu T, Bi W, Zhang Y. MicroRNA-204 deregulation in lung adenocarcinoma controls the biological behaviors of endothelial cells potentially by modulating Janus kinase 2-signal transducer and activator of transcription 3 pathway. IUBMB Life. 2018;70:81-91.
    Pubmed CrossRef
  20. Rutkowski DT, Kaufman RJ. A trip to the ER: coping with stress. Trends Cell Biol. 2004;14:20-28.
    Pubmed CrossRef
  21. Zhang JJ, Zhang YZ, Peng JJ, Li NS, Xiong XM, Ma QL, Luo XJ, Liu B, Peng J. Atorvastatin exerts inhibitory effect on endothelial senescence in hyperlipidemic rats through a mechanism involving down-regulation of miR-21-5p/203a-3p. Mech Ageing Dev. 2018;169:10-18.
    Pubmed CrossRef
  22. Zhang M, Zhou SH, Li XP, Shen XQ, Fang ZF, Liu QM, Qiu SF, Zhao SP. Atorvastatin downregulates BMP-2 expression induced by oxidized low-density lipoprotein in human umbilical vein endothelial cells. Circ J. 2008;72:807-812.
    Pubmed CrossRef
  23. Yi TN, Zhao HY, Zhang JS, Shan HY, Meng X, Zhang J. Effect of aspirin on high glucose-induced senescence of endothelial cells. Chin Med J (Engl). 2009;122:3055-3061.
    Pubmed
  24. Pagliarini V, Giglio P, Bernardoni P, De Zio D, Fimia GM, Piacentini M, Corazzari M. Downregulation of E2F1 during ER stress is required to induce apoptosis. J Cell Sci. 2015;128:1166-1179.
    Pubmed CrossRef