Korean J Physiol Pharmacol 2025; 29(2): 257-269
Published online March 1, 2025 https://doi.org/10.4196/kjpp.24.413
Copyright © Korean J Physiol Pharmacol.
Na Kyeong Park1,#, Yun-Gwi Park2,#, Ji-Hee Choi2,#, Hyung Kyu Choi2, Sung-Hwan Moon2,*, Soon-Jung Park1,*, and Seong Woo Choi3,4,*
1R&D Center, Biosovix Co. Ltd, Seoul 08502, 2Department of Animal Science and Technology, Chung-Ang University, Anseong 17546, 3Department of Physiology, Dongguk University College of Medicine, Gyeongju 38066, 4Channelopathy Research Center (CRC), Dongguk University College of Medicine, Goyang 10326, Korea
Correspondence to:Sung-Hwan Moon
E-mail: moonsh@cau.ac.kr
Soon-Jung Park
E-mail: pure_park@biosolvix.com
Seong Woo Choi
E-mail: physiolcsw@dongguk.ac.kr
#These authors contributed equally to this work.
Author contributions: N.K.P. and Y.G.P. performed the experiments. J.H.C. and H.K.C analyzed the experimental data. S.J.P. and S.W.C. coordinated the study and provided supervision. N.K.P and S.H.M wrote and reviewed the manuscript.
Reliable preclinical models for assessing drug-induced cardiotoxicity are essential to reduce the high rate of drug withdrawals during development. Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) have emerged as a promising platform for such assessments due to their expression of cardiacspecific ion channels and electrophysiological properties. In this study, we investigated the effects of eight arrhythmogenic drugs—E4031, nifedipine, mexiletine, JNJ303, flecainide, moxifloxacin, quinidine, and ranolazine—on hiPSC-CMs derived from both healthy individuals and a long QT syndrome (LQTS) patient using multielectrode array systems. The results demonstrated dose-dependent changes in field potential duration and arrhythmogenic risk, with LQTS-derived hiPSC-CMs showing increased sensitivity to hERG channel blockers such as E4031. Furthermore, the study highlights the potential of hiPSC-CMs to model disease-specific cardiac responses, providing insights into genetic predispositions and personalized drug responses. Despite challenges related to the immaturity of hiPSC-CMs, their ability to recapitulate human cardiac electrophysiology makes them a valuable tool for preclinical cardiotoxicity assessments. This study underscores the utility of integrating patientderived hiPSC-CMs with advanced analytical platforms, such as multi-electrode array systems, to evaluate drug-induced electrophysiological changes. These findings reinforce the role of hiPSC-CMs in drug development, facilitating safer and more efficient screening methods while supporting precision medicine applications.
Keywords: Arrhythmias, cardiac; Comprehensive in vitro proarrhythmia assay; Electrophysiology; Human induced pluripotent stem cells; Myocytes, cardiac
The need for reliable methods to predict drug-induced cardiotoxicity has become more urgent as cardiovascular toxicity remains a leading cause for withdrawing a drug from clinical development [1,2]. Current preclinical models, such as animal testing and non-cardiac cell lines, present significant limitations due to species-specific differences and lack of human cardio-specific properties [3]. Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) have emerged as a critical model for investigating human cardiac physiology, owing to their ability to closely mimic the genetic and physiological characteristics of human cardiomyocytes [4]. Unlike conventional models such as HEK cells, which rely on artificial overexpression of ion channels, hiPSC-CMs express a comprehensive array of cardiac ion channels and proteins, providing a more physiologically relevant platform for evaluating drug effects on human cardiac cells [5]. Despite concerns regarding the immaturity of hiPSC-CMs compared to adult cardiomyocytes — particularly in ion channel expression and contractile function — hiPSC-CMs are still considered more appropriate for cardiotoxicity assessments than non-cardiac cell lines [3,5]. The expression of cardiac-specific ion channels and contractile activity makes hiPSC-CMs a valuable tool for assessing drug-induced cardiotoxicity.
Multi-electrode array (MEA) systems enable real-time, non-invasive measurement of cellular electrical activity and are effective for evaluating cardiotoxicity and electrophysiological drug responses [5]. Validated assessments, such as the Comprehensive
In this study, we evaluated the electrophysiological effects of eight arrhythmogenic drugs (E4031, nifedipine, mexiletine, JNJ303, flecainide, moxifloxacin, quinidine, and ranolazine) on hiPSC-CMs using MEA systems. MEA technology offers a non-invasive, label-free platform to measure field potentials and detect drug-induced changes in cardiac repolarization and proarrhythmic risks [5]. We employed three healthy control cell lines (CMC-006, CMC-011, CMC-016) and one cell line (DPHC01i-AR) derived from a patient with long QT syndrome (LQTS) to assess concentration-dependent drug responses and compared the reactions of diseased versus healthy cells [2,6].
Our research builds on previous studies that emphasize the utility of hiPSC-CMs in both drug discovery and personalized medicine. hiPSC-CMs can be genetically matched to patients, providing unique insights into individual susceptibility to arrhythmogenic drugs and enabling the development of more precise therapeutic strategies [1,4]. This study further confirms the value of the MEA platform for identifying arrhythmic risks and reinforces the relevance of hiPSC-CMs as a preclinical model for cardiotoxicity testing.
Three normal human induced pluripotent stem cell (iPSC) lines (CMC-006, CMC-011, CMC-016) and one LQTS hiPSC lines (DPHC01i-AR) were obtained from the Korea Stem Cell Bank and differentiated into cardiomyocytes (iPSC-CMs) using previously described methods, with detailed information on these cell lines provided in Table 1 [7-10]. Briefly, iPSCs were seeded onto a cell culture dish coated with hESC-qualified Matrigel (Corning). 10 μM Y-27632 (Tocris) was added 24 h after the initial seeding to enhance cell survival. The medium was changed daily, and iPSCs were cultured in StemMACS iPS-Brew XF (Miltenyi Biotec) until they reached approximately 90% confluency, which typically occurred after 4 days. On the first day of differentiation (Day 0), 8 μM CHIR99021 was added to the cardiomyocyte differentiation medium (CDM), consisting of RPMI1640 (Thermo Fisher Scientific), 500 μg/ml human albumin (Sigma-Aldrich), and L-ascorbic acid-2-phosphate (Sigma-Aldrich). The medium was replaced with CDM supplemented with 2 μM Wnt-C59 after 48 h, and the cells were cultured for another 48 h under these conditions. Medium was replaced with fresh CDM. On Day 5 and then refreshed every two days. The first signs of spontaneous contractions in the cells were observed between Day 6 and Day 10. To metabolically select and purify cardiomyocytes, the medium was replaced with glucose-free RPMI1640 medium (Thermo Fisher Scientific) containing 4 mM L-lactic acid for 4 days [11,12]. The purified iPSC-CMs were subsequently cultured in Advanced MEM medium (Thermo Fisher Scientific) supplemented with 100 ng/ml of 3,3',5-triiodo-L-thyronine (Sigma-Aldrich) and 1 μM dexamethasone (Stemcell Technologies), and the medium was changed every two days for 30 days [13]. Mature iPSC-CMs were dissociated into single-cell suspensions using TrypLE (Thermo Fisher Scientific) and seeded onto glass coverslips coated with 0.1% gelatin and MEA plates. Electrophysiological recordings for analysis were performed 48 h after seeding.
Table 1 . Information on four hiPSC lines.
Cell line | Disease | Origin | Mutation | Information |
---|---|---|---|---|
CMC-006 | - | Cord Blood Cell | - | [9] |
CMC-011 | - | Cord Blood Cell | - | [9] |
CMC-016 | - | Cord Blood Cell | - | |
DPHCi-01 | LQTS | Peripheral blood | KCNH2 | [10] |
hiPSC, human induced pluripotent stem cell; LQTS, long QT syndrome.
Total RNA from hiPSC-CMs was isolated using TRIzol Reagent, according to the manufacturer’s instructions. Human Heart Total RNA (Takara Bio Inc. 636532) was purchased. The cDNA was reverse transcribed with a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). The cDNA (1 μl) was then mixed with 10 μl of FastStart Essential DNA Green Master Mixture (Thermo Fisher Scientific), 8 μl of distilled water, and forward and reverse primer (1 μl each). Primers were designed using Primer 3 for various genes, including glyceraldehyde 3phosphate dehydrogenase (
Table 2 . Real-time PCR primer sequences.
Gene | Forward sequence (5’→3’) | Reverse sequence (5’→3’) | Size (bp) | Gene Bank No. |
---|---|---|---|---|
gtatgacaacagcctcaaga | gtagaggcagggatgatgt | 216 | NM_002046 | |
gggttacatccagaagacag | gttatagatgctctgccaca | 163 | NM_000364 | |
agtatgaggagtcgcagtct | cacattctttcctccttctc | 194 | NM_002471 | |
tcaccacctacatcatcatc | gacaggaccgaatactcaat | 190 | AY038064 | |
cctccatcaaggacaagtat | gaagatgctagcgtacatga | 155 | AF363636 | |
ctactacatcggtctggtca | tgagggagaagagaagaaag | 179 | NM_004980 | |
tactttgtgtacctggctga | agatggcaaagacagagaag | 181 | AY114213 | |
ccatctacaactaccgtgtg | accacgtaccacactttgta | 247 | NM_1994603 |
Human iPSC-CMs were plated onto gelatin-coated cover slip and cultured for 5 days, fixed with 4% paraformaldehyde for 20 min at 4°C, permeabilized with 0.1% Triton X-100 for 10 min at room temperature, and blocked with Dulbecco’s phosphate-buffered saline (DPBS) containing 5% normal goat serum for 30 min at room temperature. Subsequently, the cells were stained with antibodies against cardiac Troponin T (cTnT; 1:500, Abcam) and myosin heavy chain alpha (MHCα; 1:200, Abcam) diluted in 5% normal goat serum and incubated at 4°C overnight. The cells were washed three times for 10 min with DPBS and incubated with Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (Thermo Fisher Scientific), Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, and Alexa Fluor 488 (Thermo Fisher Scientific) antibodies for 1 h at room temperature. The cells were washed three times before counterstaining the nuclei with DAPI staining solution. Samples were visualized using a confocal microscope (LSM-700; Carl Zeiss) at the Cardiovascular and Metabolic Research Core Support Center at Inje University, South Korea.
Microglass patch pipettes (World Precision Instruments) were fabricated using a PC-100 puller (Narishige) to produce pipette resistances of approximately 2–2.5 MΩ when filled with internal solution. Whole-cell currents were amplified using an Axopatch 200B amplifier and digitized through a Digidata 1550B (Molecular Devices). The collected data was analyzed with pClamp 10.1 (Molecular Devices) and Origin 2016 (OriginLab).
Action potentials (AP) from hiPSC-CMs were recorded at 37°C ± 0.5°C using an in-line heating system connected to a TC324C controller (Warner Instruments Inc.). The extracellular solution contained (in mM): 145 NaCl, 5.4 KCl, 1.8 CaCl2, 1 MgCl2, 5 glucose, and 10 HEPES, adjusted to pH 7.4 using NaOH. The internal solution consisted of (in mM): 130 K-aspartate, 20 KCl, 5 NaCl, 0.1 EGTA, 1 MgCl2, 3 MgATP, and 10 HEPES, with the pH adjusted to 7.2 using KOH.
The hiPSC-CMs were seeded onto 96-well MEA plates pre-coated with fibronectin. After confirming spontaneous contractile activity, baseline parameters were obtained using the Axion MEA system: field potential duration (FPD), rate-corrected FPD (FPDc), beat period, and peak amplitude (Amp). Axion’s Cardiac Analysis Tool was used to analyze the collected electrophysiological data. Drugs were applied at four concentrations, starting from 1x (the free clinical Cmax concentration) and increasing half-logarithmically to higher subsequent concentrations, as detailed in Table 3. The experimental protocol for this study was designed based on the drug concentrations reported by Millard
Table 3 . Test concentrations and preparation of drugs for MEA analysis of drug responses.
Drug | Test concentration | μM | Stock | 10X-media (Stock/media μl) |
---|---|---|---|---|
E4031 | #1 | 0.003 | #3 | 20/ 180 |
#2 | 0.01 | #4 | 20/ 180 | |
#3 | 0.03 | 0.01 mM | 1/ 299 | |
#4 | 0.1 | 0.01 mM | 4/ 396 | |
Nifedipine | #1 | 0.01 | #3 | 20/ 180 |
#2 | 0.03 | #4 | 20/ 180 | |
#3 | 0.1 | 0.3 mM | 1/ 299 | |
#4 | 0.3 | 0.3 mM | 4/ 396 | |
Mexiletine | #1 | 1 | #3 | 20/ 180 |
#2 | 3 | #4 | 20/ 180 | |
#3 | 10 | 30 mM | 1/ 299 | |
#4 | 30 | 30 mM | 4/ 396 | |
JNJ303 | #1 | 0.01 | #3 | 20/ 180 |
#2 | 0.03 | #4 | 20/ 180 | |
#3 | 0.1 | 0.3 mM | 1/ 299 | |
#4 | 0.3 | 0.3 mM | 4/ 396 | |
Flecainide | #1 | 3 | #3 | 20/ 180 |
#2 | 10 | #4 | 20/ 180 | |
#3 | 30 | 3 mM | 1/ 299 | |
#4 | 100 | 3 mM | 4/ 396 | |
Moxifloxacin | #1 | 3 | #3 | 20/ 180 |
#2 | 10 | #4 | 20/ 180 | |
#3 | 30 | 100 mM | 1/ 299 | |
#4 | 100 | 100 mM | 4/ 396 | |
Quinidine | #1 | 0.3 | #3 | 20/ 180 |
#2 | 1 | #4 | 20/ 180 | |
#3 | 3 | 10 mM | 1/ 299 | |
#4 | 10 | 10 mM | 4/ 396 | |
Ranolazine | #1 | 1 | #3 | 20/ 180 |
#2 | 3 | #4 | 20/ 180 | |
#3 | 10 | 30 mM | 1/ 299 | |
#4 | 30 | 30 mM | 4/ 396 |
MEA, multi-electrode array.
Data analysis was conducted using Axion’s Cardiac Analysis Software with percent change in FPD and FPDc calculated as follows: % change in FPD = (post-drug FPD / baseline FPD) * 100, with standard deviation (± SD) provided for each value. This calculation allows direct comparisons of electrophysiological effects between treated samples and untreated controls.
In line with the CiPA core protocol that ensures reproducibility across multiple testing sites, standardized cell preparation methods, experimental procedures, and analysis metrics were implemented. While the protocol provides flexibility to accommodate different platforms and cell types, it maintains consistency in key experimental elements to ensure comparability across studies [14].
Four different hiPSC lines (CMC-006, CMC-011, CMC-016, and DPHC01i-AR) successfully
When compared to adult human heart tissue, the differentiated cardiomyocytes displayed a 10-fold increase in
Electrophysiological properties were recorded from the four hiPSC-CM cell lines using whole cell patch clamps and analyzed. These parameters included action potential (AP), beat period, APD50, APD80, maximum upstroke velocity, Amp, and maximum diastolic potential to fully assess the electrical function of the cells (Fig. 3A).
APs were categorized into three types: ventricular-like, atrial-like, or nodal-like, based on their characteristic shape and parameters. Notably, more than 70% of CMC-006, CMC-011, and CMC-016 cells exhibited ventricular-like APs, suggesting that these cells closely mimic the electrical properties of ventricular cardiomyocytes (Fig. 3B, C). The remaining 30% of cells in these lines showed atrial-like or nodal-like APs (Table 4). In contrast, the DPHC01i-AR cell line, derived from a patient with LQTS, exhibited prolonged APs with distinct arrhythmic characteristics, consistent with the presentation of LQT in the source tissue. A detailed analysis of AP parameters revealed diffrences between the control and DPHC01i-AR cell lines. DPHC01i-AR exhibited prolonged APD80 and APD50 values, reflecting an increased susceptibility to arrhythmias. Interestingly, in a previous study using the same c.453delC mutation in the
Table 4 . Analysis of action potential parameter.
Cell line | Beat period (ms) | APD80 (ms) | APD50 (ms) | Vmax (V/s) | Amp (mV) | MDP (mV) |
---|---|---|---|---|---|---|
CMC-006 (n = 16) | 1,441.9 ± 809.4 | 249.5 ± 37.8 | 219.0 ± 35.8 | 20.1 ± 12.1 | 115.1 ± 3.0 | –73.8 ± 2.0 |
CMC-011 (n = 25) | 2,017.2 ± 768.3 | 288.8 ± 66.4 | 261.2 ± 64.7 | 45.7 ± 5.5 | 114.7 ± 6.1 | –76.1 ± 2.5 |
CMC-016 (n = 22) | 1,944.3 ± 874.9 | 211.5 ± 16.4 | 192.8 ± 19.2 | 22.6 ± 7.2 | 109.6 ± 3.5 | –69.1 ± 2.6 |
DPHCi-01 (n = 30) | 2,700.1 ± 2,348.9 | 276.3 ± 62.0 | 221.0 ± 73.8 | 31.7 ± 15.4 | 105.5 ± 11.6 | –69.8 ± 5.9 |
Values are presented as mean ± SEM. Vmax, maximum upstroke velocity; Amp, amplitude; MDP, maximum diastolic potential.
The responses of the four hiPSC-CM cell lines to arrhythmogenic drug exposure were evaluated using an MEA system. The eight arrhythmogenic drugs tested in this study (E4031, nifedipine, mexiletine, JNJ303, flecainide, moxifloxacin, quinidine, and ranolazine) were selected based on their known ability to affect cardiac electrophysiology and induce arrhythmias. Electrophysiological signals such as FPD, FPDc, beat period, and the peak Amp of depolarization were monitored in response to various drug concentrations and analyzed using the Cardiac Analysis Tool.
In the control cell lines (CMC-006, CMC-011, CMC-016), E4031 and nifedipine produced dose-dependent changes in FPD, with results consistent with those observed in global cell line studies. Mexiletine, a sodium channel blocker, exhibited a predictable shortening of FPD, aligning with data from four other global sites, reinforcing the reproducibility and reliability of the MEA platform in these cell lines (Fig. 4–7). In contrast, JNJ303, a calcium channel modulator, did not induce significant FPD changes in any cell line, consistent with previously reported global data that show minimal arrhythmic effects in response to this compound.
The DPHC01i-AR cell line exhibited heightened sensitivity to several of the drugs tested. Exposure to E4031, a known hERG channel blocker, induced a longer FPD than control cell lines, reflecting the drug’s propensity to exacerbate arrhythmias in DPHC01i-AR cells. Flecainide, moxifloxacin, quinidine, and ranolazine also elicited dose-dependent responses from DPHC01i-AR cells, and these effects were consistent with global benchmarks.
To compare the drug-induced responses of hiPSC-CMs across different cell lines, the parameters FPD20 and FPDc20 were defined as the drug treatment concentrations that induce more than a 20% change in FPD and FPDc, respectively (blue dot line in Fig. 4-7). These values are denoted by red-colored arrows, with arrows of greater depth representing lower FPD20 or FPDc20 (red arrows in Fig. 4-7). Additionally, the values were subsequently compared for each drug and cell line (Fig. 8). The normal cell lines exhibited FPD20 and FPDc20 changes comparable to those observed in global cell line studies [14]. Notably, the DPHC01i-AR arrythmia cell line exhibited a lower FPD20 for E4031 and mexiletine in the FPD20 analysis, and for nifedipine in the FPDc20 analysis, compared to the normal cell lines. Furthermore, mexiletine caused less than a 20% change in FPD across various treatment concentrations in the normal cell lines. However, in the DPHC01i-AR cell line, it induced more than a 20% change even at the lowest treatment concentration (red arrow at Fig. 7). The arrow indicates the FPD20 or FPDc20, with the depth of the red color representing the decrease in FPD20 or FPDc20. These findings suggest that hiPSC-CMs derived from patients with arrhythmia are particularly sensitive to drug-induced arrhythmias, making them a valuable model for preclinical cardiotoxicity testing. Comparative analyses of drug responses between control cell lines and the patient-derived cell line highlight the utility of hiPSC-CMs in detecting arrhythmogenic risks in normal and diseased cardiac cells. These results further validate the relevance of using hiPSC-CMs and MEA platforms for preclinical cardiotoxicity assessments.
The development of hiPSC-CMs has significantly advanced the field of preclinical cardiotoxicity testing. In this study, we evaluated the electrophysiological responses of hiPSC-CMs to a panel of eight drugs with varying arrhythmogenic characteristics, demonstrating the value of this model for predicting drug-induced cardiac risks [15]. This study reinforces the belief that hiPSC-CMs are a relevant tool that bridges a gap between preclinical models and human cardiac physiology, offering a reliable method for detecting drug-induced cardiotoxicity earlier in the drug development process [1].
The ability of hiPSC-CMs to naturally express a comprehensive array of cardiac ion channels makes them a more physiologically relevant platform compared to heterologous expression systems that rely on overexpression of individual channel proteins. The dose-dependent effects of drugs like E4031 and nifedipine, observed in control cell lines, highlight the reliability of hiPSC-CMs for replicating known drug responses seen in human cardiac tissue. These findings align with previous studies that support the use of hiPSC-CMs for assessing drug safety and their integration into regulatory initiatives like CiPA [4,14,16].
Moreover, the heightened sensitivity of the DPHC01i-AR cell line to E4031 and other drugs demonstrates the utility of disease-specific hiPSC-CMs for modeling genetic disorders associated with arrhythmias. The distinct electrophysiological responses observed in the DPHC01i-AR cell line not only reflect the underlying hERG channel mutation but also offer valuable insights into how patient-specific models can be used to predict individualized drug responses [8]. This supports the growing recognition of hiPSC-CMs as an essential tool for precision medicine, enabling more tailored drug safety evaluations for patients with genetic predispositions [14].
Despite the promising capabilities of hiPSC-CMs, there are still challenges that need to be addressed. One major limitation is the relatively immature state of hiPSC-CMs compared to adult cardiomyocytes. This difference may affect their ability to fully replicate the electrophysiological properties of mature heart cells [13]. Immaturity can affect AP durations and ion channel expression levels, potentially impacting the translation of in vitro findings to clinical outcomes. Mechanical and electrical stimulation have been shown to enhance contractility and electrophysiological properties, while metabolic conditioning promotes mitochondrial maturation and energy metabolism [17]. 3D culture systems can mimic the
Furthermore, some normal hiPSC-CM lines demonstrate a tendency to exhibit cardiotoxic responses to anti-arrhythmic drugs, despite being derived from healthy individuals. While normal cell lines typically demonstrate low or negligible cardiotoxicity, consistent with expectations from preclinical models, certain cell lines exhibit responses similar to those of arrhythmia patient-derived cell lines when exposed to drugs such as E4031 and nifedipine. These findings highlight the dependency on specific cell lines in cardiotoxicity evaluations using hiPSC-CMs. To enhance the accuracy of predictions for drug-induced cardiotoxicity, it is crucial to establish robust evaluation criteria based on comprehensive toxicity assessment data from both normal and arrhythmia patient-derived hiPSC-CM lines.
Integrating advanced computational tools, such as deep learning algorithms, into hiPSC-CM assays holds great potential for enhancing cardiotoxicity predictions. Recent studies show that deep learning models can identify complex electrophysiological patterns linked to proarrhythmic events with greater precision than traditional methods. This approach improves the detection of subtle signals and allows for large-scale data analysis, making hiPSC-CM assays more scalable for high-throughput drug screening [18]. Such integration not only accelerates and streamlines the drug discovery process but also enables a more effective and cost-efficient assessment of the proarrhythmic potential of various drugs. Additionally, combining experimental data with computer model-based simulations provides a more robust validation framework for predicting the electrophysiological properties of drugs [19]. For instance, machine learning algorithms can preemptively predict the risk profiles of specific drugs, enabling a hybrid approach that combines experimental methodologies with computational models. Leveraging these technologies could refine the predictive power of hiPSC-CMs, broadening their role in drug discovery and personalized medicine [3]. We plan to further investigate the application of these computational tools in combination with hiPSC-CM models to improve the accuracy and personalization of cardiotoxicity screening. This ongoing research will focus on optimizing algorithms for the specific characteristics of patient-derived cardiomyocytes, with the ultimate goal of enhancing preclinical drug testing and patient safety.
In conclusion, this study demonstrates the utility of hiPSC-CMs as a model for preclinical cardiotoxicity testing. The results highlight the ability of hiPSC-CMs to detect drug-induced electrophysiological changes and the promise of hiPSC-CMs to improve drug safety evaluations, especially when combined with advanced analytical techniques. As hiPSC-CMs continue to mature and their limitations are addressed, they are likely to play a central role in future drug safety testing frameworks, offering a more accurate and patient-specific assessment of cardiotoxic risks.
Supplementary data including four videos can be found with this article online at https://doi.org/10.4196/kjpp.24.413
The hiPSC cell lines were obtained from the Korea National Stem Cell Bank.
The authors declare no conflicts of interest.
This work was supported by the Bio & Medical Technology Development Program (grant number RS-2023-00220207) of the National Research Foundation of Korea (NRF), funded by the Ministry of Science and ICT (MSIT), additional grants from the NRF, also funded by MSIT (grant numbers 2022R1A2C1006622 and RS-2023-00213304) and partly supported by the Technology development Program of MSS (grant numbers RS-2023-00303986) of Korea.
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
ⓒ 2019. The Korean Journal of Physiology & Pharmacology. Powered by INFOrang Co., Ltd