Colorectal cancer (CRC) is a prevalent cancer whose incidence can be substantially decreased by effective cancer screening measures [1,2], however, it still ranks the fourth lethal cancer with approximately 900,000 deaths annually [3]. The incidence is increasing in the young, indicating unhealthy lifestyle, such as obesity and less exercise can be another risk factor for CRC, aside from environmental and genetic factors [4]. Surgery is widely applied in elderly patients, while for those with metastasis in advanced stages, combined therapy of chemotherapeutic intervention coupled with surgery is the mainstay therapy strategy for long term survival [5,6]. Cancer is characterized by gene dysregulation, and evidence has shed light on the role and effect of gene transcription in cancer progression [7], which showed that the bulk of transcription factor is associated with human diseases, including cancer [8]. Specifically, the tissue-specific transcription reprogramming is proved to promote CRC cells metastasis to the liver [9]. Much remains to be explored concerning the emerging role of transcription factors in cancer progression.

Yin Yang 1 (YY1) is a zinc finger protein of the GLI-Kruppel family and known for its association with multiple cellular processes in tumor cells, including cell proliferation, survival, and metabolic reprogramming [10]. Tumor cells are capable of uncontrolled proliferation and angiogenesis, and YY1 is highly expressed in multiple cancer cells, including hepatocellular carcinoma, melanoma and breast cancer [11-14]. Depending on the context, YY1 can act as a transcriptional activator or as an inhibitor [15], although the mechanism by which YY1 functions both as a transcriptional activator and repressor is not completely clear. In CRC cell, YY1 was showed to rescue the effects of miR-215 on colon cancer cells, and therefore inhibit cell apoptosis and enhance cell proliferation [16]. However, how YY1 regulates downstream targets in CRC cells remains to be determined.

RNA polymerase I and III complexes are capable of regulating cell growth and cell cycle in all cells [17]. RNA polymerase I subunit D (POLR1D), whose implication in promoting cancer progression was reported in previous literature, is associated with the synthesis of ribosomal RNA precursors and small RNAs [18]. For instance, in CRC cells, POLR1D was showed to mediate cell proliferation and regulate VEGFA expression to resist to bevacizumab treatment [19]. Clinical data supported the association of POLR1D expression with clinic-pathological features, including tumor differentiation and metastasis of CRC [20]. Online software predicted the interaction sites between YY1 and POLR1D, therefore we speculated there may be certain relationship between POLR1D and YY1 in regulating proliferation and angiogenesis of CRC cells.

Collection of CRC tissues

The 22 pairs of surgical resected CRC tissues were taken from the sample bank of Xinchang People’s Hospital. The adjacent normal tissues (≥ 5 cm away from CRC tissues) from the same patients were also collected as controls. The inclusion criteria were: 1) Diagnosed with primary CRC by two experienced pathologist using double-blind method based on The 2019 WHO classification of tumors of the digestive system; 2) Diagnosed with CRC for the first time; and 3) No history of neoadjuvant chemotherapy. The exclusive criteria were: 1) Complicated other primary tumor in other part of the body; 2) Lung metastasis or peritoneum metastasis; and 3) Incomplete clinical record. The experiment was approved by the ethical committee of Xinchang People’s Hospital (approval number: 2023-K-003-01) and all included patients signed consents before tissues collection.

Cell culture

Human umbilical vein endothelial cells (HUVECs), human intestinal epithelial cell line (NCM460) and human CRC cell lines (HCT-116, SW480, LOVO and HT-29) were purchased form Institute of Cell Research of Chinese Academy of Sciences (Shanghai). Cells were cultured in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific) in which 10% fetal bovine serum (Thermo Fisher Scientific) was supplemented at 37°C with 5% CO₂. Water-soluble SB 203580 was purchased from Calbiochem and 0 μM Water-soluble SB 203580 was used to treat SW480 and HT-29 cells 24 h to suppress the p38 MAPK signal pathway [21].

Plasmid construction and cell transfection

pcDNA3.1-YY1 (YY1), pcDNA3.1-POLR1D (POLR1D) and empty plasmid (pcDNA3.1), si-YY1, si-POLR1D and negative control (si-NC) were purchased from GenePharma. Cells in logarithmic phase were seeded into a 6 well plate with 4 × 10⁵ cells per well. When cell confluence reached 50%, cell transfection was performed according to the instruction using Lipofectamine 2000 (Invitrogen). The transfected cells were cultured for 24 h at 37°C before further experiments.

TRIZOL (Invitrogen) was utilized to extract the total RNA, which was then reverse transcript into cDNA using a transcription kit (TaKaRa) in according to the instruction in the kit. LightCycler 480 (Roche) was used to detect the gene expression and the reaction condition was set in according to the instruction in the quantitative PCR kit (SYBR Green Mix, Roche Diagnostics). The parameters were set as follow: 95°C 10 sec, 45 cycles of 95°C 5 sec, 60°C 10 sec and 72°C 10 sec, and then extension at 72°C for 5 min. Three duplicates were set and GAPDH was used as the internal control. Data were analyzed using 2^-ΔΔCt method: ΔΔCt = experimental group (Ct target gene – Ct Control) – control group (Ct target gene – Ct Control). The primer sequences are listed in Table 1.

Table 1 . Primer sequences for reverse transcription polymerase chain reaction.

Name of primer	Sequences
YY1-F	AAAACATCTGCACACCCACG
YY1-R	GTCTCCGGTATGGATTCGCA
POLR1D-F	AAGACAGCCCTGGAAATGGTCC
POLR1D-R	GGATGGGTCGTAGTGTAACCAC
GAPDH-F	CCAGGTGGTCTCCTCTGA
GAPDH-R	GCTGTAGCCAAATCGTTGT

F, forward; R, reverse.

Western blot

RIPA buffer from Beyotime was used for cell lysis. The obtained proteins were subjected to concentration measurement using a BCA kit (Beyotime). Then the proteins were mixed with loading buffer (Beyotime) in boiling water bath for 3 min before electrophoresis at 80 V for 30 min and 120 V for 1–2 h. The proteins were transferred into membranes at ice water bath with the current of 300 mA for 60 min, after which the membrane was washed for 1–2 min before blocking at room temperature for 60 min or overnight at 4°C. The proteins were then incubated with primary antibody of GAPDH (#ab9485, 1:1,000, Abcam), YY1 (#ab109228, 1:1,000, Abcam), POLR1D (#DF9464, 1:1,000, Affinity), p38 (#ab170099, 1:1,000, Abcam), phosphorylated-p38 MAPK (#4511S, Cell Signaling Technology) at room temperature in a shaking table for 1 h, followed by washing for 10 min × 3 times. Then secondary antibody (horseradish peroxidase labeled goat anti rabbit IgG) was used for incubation at the room temperature for 1 h and the proteins were washed for 10 min × 3 times. The membranes were added with developing solution and the bands were detected in chemiluminescence Imaging System (Bio-Rad).

CCK-8 assay

About 24 h after cell transfection, SW480 and HT-29 cells were seeded into a 96 well plate, in which 100 μl diluted cell suspension (1 × 10⁶ cells/ml) was added into each well. Each group was set with three duplicated wells and cells were incubated for respectively 24 h, 48 h, 72 h and 96 h before 10 μl of CCK-8 reagent (Dojindo) was added for incubation of 24 h. The optical density at 490 nm was determined.

Clone formation assay

About 24 h after cell transfection, SW480 and HT-29 cells were digested with pancreatin and then centrifuged at 1,500 rpm at 25°C for 5 min. Then cells were added complete culture medium for cell suspension, followed by culture at 37°C with 5% CO₂ for 2–3 weeks after 500 cells per well were seeded into 37°C pre-warmed 6-well plates in which 2 ml complete culture medium was supplemented. The cell culture was terminated in response to cell clones visible by naked eyes. The culture medium was abandoned and cells were washed with PBS for 3 times before 1.5 ml methanol was added per well for cell fixation of 15 min. The methanol was removed and 1ml Giemsa solution was added for staining for 20 min without light exposure. The cells were then washed in running water to remove the Giemsa solution and the cells in the 6-well plate were put upside down on the paper to absorb the excessive water. Cell clones were counted by naked eyes or under a microscope with low power lens.

Tube formation assay

HUVECs were seeded in the 24-well plate in which 300 μl matrigel was added per well for response of 1 h at 37°C. SW480 and HT-29 cell suspension (2 × 10⁵ cells/ml) was seeded into a matrigel coated plate with 500 μl per well for cell culture at 37°C for 24 h with 5% CO₂. The tube formation was observed under a light microscope. Five fields were randomly selected to detect the tube formation length using ImageJ software.

Dual luciferase reporter gene assay

The binding sites of YY1 with POLR1D were predicted by Jaspar (http://jaspar.genereg.net/). According to the prediction, the mutant and wide sequences (wt-POLR1D and mut-POLR1D) were designed and synthesized before being inserted into pGL3-basic and then co-transfected with YY1 overexpression plasmid (YY1; 30 nM) or empty plasmid (pcDNA3.1; 30 nM) into SW480 and HT-29 cells. About 24 h after cell transfection, the Firefly and Renilla luciferase activities were measured using dual luciferase reporter gene detection system (Promega). Renilla activity was used as the control and the ratio of Firefly and Renilla luciferase activities was considered as the luciferase relative activity.

Chromatin immunoprecipitation (ChIP)

ChIP DNA purification kit was used for ChIP analysis based on the instruction. Chromatin supernatant of cells was incubated with 1 μg IgG or anti-YY1 (Abcam) at 4°C with rotation. Then the protein/DNA complex was reversely crosslinked with dissociated DNA. The collected DNA enriched by ChIP was subjected to quantitative real-time polymerase chain reaction (qRT-PCR) using ABI 7900HT and SYBR green master mix detection system.

Statistical analysis

GraphPad Prism 5.0 (GraphPad Software Inc.) was used for data analysis. All data were expressed as mean ± standard deviation. Comparison for data between two groups was determined using t-test, while that among multiple groups was assessed using one-way analysis of variance and Tukey’s multiple comparisons test. The correlation between YY1 and POLR1D was determined by Pearson analysis. p-value of less than 0.05 was used as the standard of statistical significance.

POLR1D and YY1 were increasingly expressed in CRC tissues and cells

TCGA database showed that POLR1D and YY1 expression levels were highly expressed in CRC patients by GEPIA analysis (Fig. 1A, B). The survival rate of CRC patients with high YY1 expression is shown in Supplementary Fig. 1. In addition, the expression level of POLR1D was associated with overall survival of CRC patients (Fig. 1C). Measurement by qRT-PCR and Western blot on POLR1D and YY1 expression levels on CRC cell lines showed that compared with NCM460 cells, the mRNA and protein expressions of POLR1D and YY1 in CRC cell lines were increased (Fig. 1D, E). The detection on CRC tissues and adjacent normal tissues demonstrated that POLR1D and YY1 were highly expressed in CRC tissues (Fig. 1F, G). Pearson analysis proved that YY1 expression was positively correlated with POLR1D expression (Fig. 1H). Collectively, increased expressions of POLR1D and YY1 may associate with the initiation and development of CRC.

Figure 1. Increased expression levels of POLR1D and YY1 in CRC tissues and cell lines. (A, B) The expression levels of POLR1D and YY1 in CRC patients were analyzed by GEPIA in TCGA database. (C) Kaplan–Meier method was used to analyze the correlation between POLR1D expression level and overall survival of CRC patients in TCGA database. (D, E) qRT-PCR and Western blot were applied to detect the mRNA and protein expression levels of POLR1D and YY1 in CRC cell lines. (F, G) CRC tissues and their adjacent normal tissues were collected from 22 CRC patients. qRT-PCR was used to detect the mRNA expressions of POLR1D and YY1. (H) Pearson method was used to analyze the correlation between POLR1D and YY1. Data were presented as mean ± SD. CRC, colorectal cancer. *p < 0.05, **p < 0.01, ***p < 0.001.

Silencing of POLR1D inhibits the proliferation and angiogenesis ability of CRC cells

SW480 and HT-29 cells were transfected with POLR1D siRNA to achieve POLR1D silencing. qRT-PCR and Western blot verifying the transfection efficiency showed that cells in si-POLR1D group had suppressed POLR1D mRNA and protein expression levels compared with si-NC group (Fig. 2A, B). CCK-8 and clone formation assay showed that compared with si-NC group, silencing of POLR1D led to suppressed cell proliferation ability (Fig. 2C, D). Tube formation assay on angiogenesis ability demonstrated that silencing of POLR1D resulted in suppressed cell angiogenesis ability of HUVECs (Fig. 2E). Collectively, down-regulation of POLR1D can suppress the proliferation and angiogenesis ability of CRC cells.

Figure 2. POLR1D silencing inhibits the cell proliferation of CRC cells and angiogenesis ability of HUVECs. After SW480 and HT-29 cells were transfected with si-NC or si-POLR1D, qRT-PCR (A) and Western blot (B) were applied to detect the mRNA and protein expressions of POLR1D. The cell proliferation ability was assessed by CCK-8 (C) and clone formation assay (D). Tube formation assay was applied to detect the angiogenesis ability of HUVECs. Scale bar, 20 μm (E). Data were presented as mean ± SD. CRC, colorectal cancer; HUVECs, human umbilical vein endothelial cells. *p < 0.05, **p < 0.01, ***p < 0.001.

YY1 binds with POLR1D promoter to promote POLR1D expression

YY1 was found to be unregulated in CRC cell lines [22,23] and we also shown the positive expression between YY1 and POLR1D, which intrigued us to wonder the possible interaction between YY1 and POLR1D. JASPAR predicted the binding sites between YY1 and POLR1D promoter (Fig. 3A). Then dual luciferase reporter gene assay was used to verify the interaction. Overexpression of YY1 can substantially increase the luciferase activity of POLR1D promoter compared with control group, while in response to mutation in YY1 binding sites, overexpression of YY1 had no significant effect on luciferase activity (Fig. 3B). ChIP also confirmed the interaction between YY1 and POLR1D transcription area (Fig. 3C). Collectively, those results supported the interaction between POLR1D promoter and YY1. Meanwhile, we also noticed that overexpression of YY1 can increase the mRNA and protein expressions of POLR1D, while silencing of YY1 can significantly suppress the mRNA and protein expressions of POLR1D (Fig. 3D, E). Taken together, YY1 can bind with POLR1D promoter and activate POLR1D transcription to increase its expression.

Figure 3. YY1 can bind with the promoter of POLR1D to increase its transcription and elevate its expression level. SW480 and HT-29 cells were transfected with pcDNA3.1, YY1, si-NC or si-YY1. JASPAR was used to predict the binding sites and the mutant sequences between YY1 and POLR1D promoter (A). The interaction between YY1 and POLR1D was verified by dual luciferase reporter gene assay (B) and ChIP (C). qRT-PCR (D) and Western blot (E) were used to detect POLR1D mRNA and protein expression levels. Data were presented as mean ± SD. CRC, colorectal cancer. *p < 0.05, **p < 0.01.

POLR1D activated by YY1 transcription regulates p38 MAPK signal pathway to promote the proliferation and angiogenesis ability of CRC cells

To evaluate the effect of YY1 regulated POLR1D on CRC cell biological function, we achieved YY1 silencing, overexpression of POLR1D or YY1 silencing + overexpression of POLR1D in SW480 and HT-29 cells. Detection on cell proliferation ability showed that cell proliferation ability in si-YY1 group was significantly decreased compared with si-NC group, but enhanced in cells with POLR1D overexpression. Co-transfection of si-YY1 and POLR1D in SW480 and HT-29 cells lead to elevated cell proliferation compared with si-YY1 group (Fig. 4A, B). Measurement on angiogenesis ability by tube formation assay showed that the angiogenesis ability of HUVECs in si-YY1 group was substantially decreased when compared with si-NC group. Overexpression of POLR1D can increase cell angiogenesis ability, and the angiogenesis ability in si-YY1 + POLR1D group was also elevated compared with si-YY1 group (Fig. 4C). These results supported that YY1 can promote the cell proliferation and angiogenesis of CRC cells, while silence of POLR1D expression can abolish the enhancive effect of YY1 on CRC cells.

Figure 4. POLR1D activated by YY1 can regulate CRC cell proliferation and angiogenesis ability through p38 MAPK signal pathway. After SW480 and HT-29 cells were transfected with si-NC, si-YY1, pcDNA3.1 and POLR1D or 10 μM SB 203580, the cell proliferation was detected by using CCK-8 assay (A) and clone formation assay (B). The angiogenesis of HUVECs was assessed by tube formation assay. Scale bar, 20 μm (C). Western blot was used to detect the protein expression levels of p38 MAPK signal pathway related proteins (D). Data were presented as mean ± SD. CRC, colorectal cancer; HUVECs, human umbilical vein endothelial cells. *p < 0.05, **p < 0.01, ***p < 0.001.

p38 MAPK signal pathway is well reported for its implication in tumor progression, including CRC [24,25]. In this study, we further determined whether YY1/POLR1D axis regulates CRC progression through regulating p38 MAPK signal pathway. Western blot demonstrated that SW480 and HT-29 cells transfected with si-YY1 had reduced expression levels of p-p38/p38 when compared with si-NC. Overexpression of POLR1D in SW480 and HT-29 cells enhanced the phosphorylation of p38. Cells co-transfected with si-YY1 and POLR1D overexpression showed higher p-p38/p38 expression level than that in si-YY1 group. p38 MAPK suppressor SB 203580 (10 μM) was used to treat pcDNA3.1-POLR1D transfected SW480 and HT-29 cells and the detection showed that SB 203580 can significantly suppress the phosphorylation of p38 (Fig. 4D). Taken together, silencing of YY1 inhibits the activation of p38 MAPK signal pathway, while overexpression of POLR1D activates the p38 MAPK signal pathway. Interestingly, further experiments showed suppression on p38 MAPK signal pathway can partially reverse the cell proliferation and angiogenesis of CRC cells resulted from POLR1D overexpression (Fig. 4A–C). Altogether, YY1 can promote the proliferation and angiogenesis ability of CRC cells through POLR1D mediated p38 MAPK signal pathway.

YY1 is a transcription protein and has been previously reported for its implication in CRC. In our study, we demonstrated that YY1 and POLR1D expressions were up-regulated in CRC cell lines and further exploration identified that YY1 can bind the POLR1D promoter to increase POLR1D expression. In addition to that, we also noticed that POLR1D can activate the p38 MAPK signal pathway in CRC cell lines to enhance cell proliferation and angiogenesis ability. Therefore, we speculated YY1 can interact with POLR1D in CRC cells to increase POLR1D expression, and then consequently result in the activation of the p38 MAPK signal pathway to increase cell proliferation and angiogenesis ability of CRC cells.

The elevated expression of YY1 in CRC has been reported in a previously published research, in which YY1 was showed to have certain relationship with the clinic-pathological characteristics, the cancer-specific survival and the recurrence-free survival of CRC patients [26]. Data extracted from TCGA database also showed that YY1 was increasingly expressed in CRC tissues, which was consistent with the measurement on CRC cell lines SW480 and HT-29. Similar results can also be found in database that supported the implication of YY1 in CRC proliferation and metastasis [27]. In a previous study by Zhang et al. [28], the overall survival of 212 CRC patients was analyzed by Kaplan–Meier method, in which CRC patients with overexpression of YY1 had decreased survival period than those with decreased expression of YY1. In this study, analyzed the association of YY1 expression with overall survival of CRC patients using the data from GEPIA, UALCAN and StarBase, but failed to show any significant difference between YY1 expression and the overall survival of CRC patients. This discrepancy may due to the limitation of sample size and ethnic population, which requires further evidence to show the association between YY1 expression and CRC prognosis. In addition to that, this study also found up-regulated expression of POLR1D was also found in CRC tissues and cell lines and overexpression of POLR1D can promote cell proliferation and angiogenesis ability of CRC cells. This expression pattern was also supported by previous study which identified the prognostic value of POLR1D expression in CRC [20]. Consistently, a previous study highlighted that the amplification of POLR1D expression can mediate cell proliferation and VEGFA expression in CRC cells to impact the sensitivity of bevacizumab [19]. Previous studies focused more on the clinical significance of POLR1D for CRC, but in this study, we achieved POLR1D suppression and overexpression in CRC cell line and found that inhibition or overexpression on POLR1D expression can mediate the proliferation and angiogenesis ability of CRC cells, which consistent with published data highlighted the tumor promotive role of POLR1D in CRC progression.

The novelty of this study was that we found the possible interaction between YY1 and POLR1D. Online software and dual luciferase reporter gene assay showed that YY1 can bind the promoter of POLR1D and elevate the POLR1D expression. This binding was confirmed by ChIP, qRT-PCR and Western blot. In addition to that, qRT-PCR showed that silencing of YY1 can significantly decrease mRNA and protein expressions of POLR1D. Further rescue experiment on CRC cell lines showed that suppression on YY1 can suppress CRC proliferation and angiogenesis ability of CRC cells, which can be overruled by further overexpression of POLR1D, indicating that YY1 promotes CRC proliferation and angiogenesis by regulating POLR1D expression, and proposing the possibility that POLR1D transcription can be activated by YY1 in CRC cells. Aside from CRC, POLR1D is more commonly researched in Treacher Collins syndrome, in which the mutations of POLR1D, TCOF1, POLR1C associated with RNA polymerase I (Pol I) transcription should be responsible for the majority of the cases [29]. As far as we known, both POLR1D and YY1 have been reported for its implication in CRC, but our study highlighted the regulation of YY1 on POLR1D expression in CRC cells.

Additionally, we further explored the downstream signal pathway of YY1/POLR1D axis. Data in previous study demonstrated that p38 MAPK signal pathway is implicated in tumor progression, including CRC [24,25]. In our study, we measured the expression levels of p-p38/p38 in CRC cell lines in response to YY1 inhibition or/and POLR1D overexpression, which demonstrated that overexpression of POLR1D can reverse the effect of YY1 inhibition on p38 MAPK signal pathway. To further validate this result, 10 μM SB 203580 was used to suppress p38 MAPK in SW480 and HT-29 cells and the results showed that suppression on p38 MAPK signal pathway in CRC cells can abolished the promotive effect of POLR1D overexpression on cell proliferation and angiogenesis. The regulation of YY1 on p38 MAPK signal pathway can be found in glioblastoma cells, in which SNHG5 can be activated by YY1 [30]. Additionally, in ionizing radiation conditions, YY1 was reported to be activated by p38 MAPK signal pathway [31]. The implication of POLR1D/YY1 in CRC can be found in previous studies, but the regulation of POLR1D/YY1 on p38 MAPK signal pathway in CRC cell lines was rarely reported. This study proposed a new possible mechanism of YY1/POLR1D axis in regulating CRC proliferation and angiogenesis ability.

In summary, collected evidence showed that both YY1/POLR1D were increasingly expressed in CRC cell lines and identified the regulation of YY1 on POLR1D expression. In addition to that, inhibition of YY1 can suppressed the activation of p38 MAPK signal pathway, which can be reversed by POLR1D overexpression. In this study, we only verify the mechanism of YY1 activated POLR1D expression in vitro, it would be interesting to reveal such a regulation occurs in vivo. In addition, no clinical sample was included in this research and only data from TCGA database were included. It is indeed one of the limitations of this research caused by tight budget. Nevertheless, this limitation also gives us a future direction to explore the clinical significance of YY1 and POLR1D in CRC patients.

Supplementary data including one figure can be found with this article online at https://doi.org/10.4196/kjpp.2024.28.3.265

None.

^FUNDING

None to declare.

^{CONFLICTS OF INTEREST}

The authors declare no conflicts of interest.