Table. 1.

Specific primer sequences for qRT-PCR

Primer name Forward sequence Reverse sequence
U6 CGCTTCGGCAGCACATATAC TTCACGAATTTGCGTGTCATC
miR-21-5p TCGCCCGTAGCTTATCAGACT CAGAGCAGGGTCCGAGGTA
β-actin CGTGGACATCCGCAAAGA GAAGGTGGACAGCGAGGC
PARP-1 CCCCACGACTTTGGGATGAA AGACTGTAGGCCACCTCGAT
E-cadherin TGATTCTGCTGCTCTTGCTG CAAAGTCCTGGTCCTCTTCTCC
N-cadherin GATCCTACTGGACGGTTCGC ACTGAGGCGGGTGCTGAA
Vimentin AGTCCACTGAGTACCGGAGAC CATTTCACGCATCTGGCGTTC
ZEB1 GATGATGAATGCGAGTCAGATGC ACAGCAGTGTCTTGTTGTTGT
Snail GCCTGTCTGCGTGGGTTT TGAGTCTGTCAGCCTTTGTCC
Korean J Physiol Pharmacol 2022;26:239-253 https://doi.org/10.4196/kjpp.2022.26.4.239
© Korean J Physiol Pharmacol