Table. 1.

Quantitative PCR primer sequences used in this study

Gene Sequence (5'-3') NCBI gene No.
NAMPT Forward: GAAGTACAGAGGCACCACTAATC NM_021524.2
Reverse: TCAGCAACTGGGTCCTTAAAC
BSP Forward: GAAGGCTGGAGATGCAGAAA NM_008318.3
Reverse: CATCCTCATAAGCTCGGTAAGTG
DMP-1 Forward: CTGTCATTCTCCTTGTGTTCCT NM_001359013.1
Reverse: GTCGTCTTCATCATCCTCCTTATC
DSPP Forward: GAAGAGCCAAGATCAGGGAATAG NM_010080.3
Reverse: CACTTTCGTCACTTCCGTTAGA
ALP Forward: GGCCTGGATCTCATCAGTATT NM_007431.3
Reverse: CCACAGTCAAGGTGTCTTTCT
Col-1 Forward: GCCAAGAAGACATCCCTGAA NM_007742.4
Reverse: AGGACATCTGGGAAGCAAAG
GAPDH Forward: GGGTGTGAACCACGAGAAATA NM_001289726.1
Reverse: GTTGAAGTCGCAGGAGACAA

NCBI, National Center for Biotechnology Information; NAMPT, nicotinamide phosphoribosyltransferase; BSP, bone sialoprotein; DMP-1, dentin matrix protein-1; DSPP, dentin sialophosphoprotein; ALP, alkaline phosphatase; Col-1, collagen type-1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Korean J Physiol Pharmacol 2022;26:37-45 https://doi.org/10.4196/kjpp.2022.26.1.37
© Korean J Physiol Pharmacol